LOC118962389 (dcdc1)



Basic Information


Item Value
gene id LOC118962389
gene name dcdc1
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048565.1
NCBI id CM023219.2
chromosome length 95772356
location 46469496 ~ 46477752 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>XR_005050124.1
GCTGGAGGAAGGCTGTGAGGACGAGCTGGAGGAAGGCTGGGAGGACGAGCCGGAGGAAGGCTGTGAGGACGAGTTGGAGGAAGGCTGTGAGGACGAGCTGGAGGAAGGCTGTGAGGACGACGGCACGGTTATGATGGACTGGGGCTCCTCACGATGCTGCACTGTCCCTGGGTGGTGGAGAAGGCTCTGGCGGCAGGGGATAGGGGTTACCACCATGCTGTGTACAGAGCACCGCTGGATCCAGACACAGCACTACCTACAGGCTTCAAAAAACGGGAGGCTGTGGAAGGATTTCCGTTTGACAGAAGCCAATCAACTGAGACCATACGGGCCTTAAAGTCACGGTGGACTCTGATGCCCACTTCACACAGCTCAAGACAGGGGAGATCCTGAGCAAGGCCCTGCCCCAGCTCGGCCTGGCTGTCTCCTCCATGACAGTCTCTTCTGGAGGACCCGGAGGGCTTCCTCATACCCAGAGGCCCACGTGCTCAACATACGGAGAAGGTGCCCGCTACACTTTCATCTGGATCAAAAGGGCAGTCCATTTCAACGGTGGAGCTTTGGAGAAGATGGCAGCATTTCT

Function


symbol description
dcdc1 Enables microtubule binding activity. Involved in regulation of mitotic cytokinesis. Located in Flemming body and mitotic spindle.

NR:

description
PREDICTED: doublecortin domain-containing protein 1 isoform X2

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
XR_005050124.1 True 583 mRNA 0.58 5 46469496 46477752
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110523948 LOC106573232 coding upstream 202241 46249719 ~ 46267255 (+)
wt-t1a wt-t1a coding upstream 309974 46142006 ~ 46159522 (+)
LOC110523825 LOC106573223 coding upstream 997983 45466496 ~ 45471513 (+)
LOC118964647 NA coding upstream 1014669 45452036 ~ 45454827 (+)
LOC110523812 facr1 coding upstream 1023083 45427670 ~ 45446413 (+)
LOC118964304 dcdc5 coding downstream 21258 46499010 ~ 46503478 (+)
LOC110532345 dcdc5 coding downstream 26062 46503814 ~ 46505112 (+)
LOC118964305 NA coding downstream 27496 46505248 ~ 46508046 (+)
LOC118966744 NA coding downstream 34784 46512536 ~ 46512590 (+)
LOC110524001 mppd2 coding downstream 47606 46525358 ~ 46575941 (+)
G50497 NA non-coding upstream 3946 46465282 ~ 46465550 (+)
G50496 NA non-coding upstream 5019 46464237 ~ 46464477 (+)
G50495 NA non-coding upstream 5309 46463977 ~ 46464187 (+)
G50490 NA non-coding upstream 8680 46460606 ~ 46460816 (+)
G50483 NA non-coding upstream 16513 46452689 ~ 46452983 (+)
G50601 NA non-coding downstream 177933 46655685 ~ 46668051 (+)
G50633 NA non-coding downstream 281061 46758813 ~ 46759118 (+)
G50642 NA non-coding downstream 294988 46772740 ~ 46773045 (+)
G50645 NA non-coding downstream 300415 46778167 ~ 46778399 (+)
G50661 NA non-coding downstream 329594 46807346 ~ 46809439 (+)
G50010 LOC106573227 other upstream 476605 45992273 ~ 45992891 (+)
G49335 LOC106573225 other upstream 732716 45730241 ~ 45736780 (+)
G49142 NA other upstream 1051316 45414706 ~ 45418180 (+)
G48976 NA other upstream 1322856 45145278 ~ 45146640 (+)
LOC110523657 NA other upstream 1397067 45071354 ~ 45072433 (+)
LOC110524042 NA other downstream 380156 46854230 ~ 46861465 (+)
LOC110520864 NA other downstream 749494 47227246 ~ 47260224 (+)
G52080 NA other downstream 1528922 48006674 ~ 48024958 (+)
G52324 NA other downstream 1902790 48380542 ~ 48383257 (+)
G53181 NA other downstream 2415745 48893497 ~ 48893912 (+)

Expression


LOC118962389(dcdc1) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 0.6.
End of interactive chart.

LOC118962389(dcdc1) Expression in each Bioproject

Bar chart with 9 bars.
LOC118962389(dcdc1) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 20.
End of interactive chart.

Co-expression Network