G3202 (sned1)


Basic Information

Item Value
gene id G3202
gene name sned1
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048565.1
NCBI id CM023219.2
chromosome length 95772356
location 4277168 ~ 4277440 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU4157
ATGTGGTGAAGGCCAGGTGCTGTGGTACGCTGTGAATCTGTTCCTGTCCCGTGTTCCTAACAGCCGTGAGAGCAAGGTGGTAGTGCTGTCCCGGAGAAAGCTCTCTCAGGGTATACGTCTCTAACTTCCCATTGGGTAGGAAGCGGCTCCGGGTGCTCAGGCCTCGCGTCACATTGACCACGAAGCCGTCTGGCAGGTTCCTGGGATGGTGGTCCCACGTCACCAGGGCAGAGTTGGAGGTCACATGTGCCAAAGACAGGTTCTGAGGGGGGA

Function

symbol description
sned1 Predicted to enable Notch binding activity. Predicted to act upstream of or within cell-matrix adhesion. Orthologous to human SNED1 (sushi, nidogen and EGF like domains 1).

NR:

description
PREDICTED: sushi, nidogen and EGF-like domain-containing protein 1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU4157 True 273 lncRNA 0.40 1 4277168 4277440

Neighbor

gene id symbol gene type direction distance location
im:7152348 LOC106573986 coding upstream 424159 3848517 ~ 3853009 (+)
trnap-ugg NA coding upstream 429209 3847888 ~ 3847959 (+)
trnap-cgg NA coding upstream 429474 3847623 ~ 3847694 (+)
LOC118965227 NA coding upstream 451303 3822517 ~ 3826226 (+)
bcl6aa LOC106574104 coding upstream 652586 3602663 ~ 3624582 (+)
agxta LOC105025628 coding downstream 671287 4948727 ~ 4957086 (+)
LOC110526525 LOC106613452 coding downstream 1386731 5664171 ~ 5767693 (+)
LOC110527749 armc9 coding downstream 2281627 6559067 ~ 6651795 (+)
b3gnt7 b3gnt7 coding downstream 2406659 6684099 ~ 6700304 (+)
alpi.1 LOC106574189 coding downstream 2751110 7028550 ~ 7056518 (+)
G3198 NA non-coding upstream 14094 4261515 ~ 4263074 (+)
G3183 NA non-coding upstream 66217 4201815 ~ 4210951 (+)
G3184 NA non-coding upstream 71158 4205456 ~ 4206010 (+)
G3178 NA non-coding upstream 89585 4187032 ~ 4187583 (+)
G3177 NA non-coding upstream 94337 4178090 ~ 4182831 (+)
G3204 NA non-coding downstream 1966 4279406 ~ 4279631 (+)
G3205 NA non-coding downstream 3967 4281407 ~ 4282416 (+)
G3211 NA non-coding downstream 12327 4289767 ~ 4290859 (+)
G3232 NA non-coding downstream 79999 4357439 ~ 4435484 (+)
G3354 NA non-coding downstream 167441 4444881 ~ 4453583 (+)
G3176 NA other upstream 99095 4175323 ~ 4178073 (+)
G2464 NA other upstream 773587 3503269 ~ 3503581 (+)
G2343 NA other upstream 1060934 3214697 ~ 3216234 (+)
G2016 NA other upstream 1631999 2644335 ~ 2645169 (+)
G998 LOC106576565 other upstream 2013603 2258883 ~ 2305334 (+)
G3234 NA other downstream 121464 4398904 ~ 4399444 (+)
G3351 NA other downstream 162526 4439966 ~ 4441908 (+)
G3596 NA other downstream 577081 4854521 ~ 4856248 (+)
G3597 NA other downstream 579085 4856525 ~ 4857065 (+)
G5276 NA other downstream 2240042 6517482 ~ 6518189 (+)

Expression


Co-expression Network