G9241



Basic Information


Item Value
gene id G9241
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048565.1
NCBI id CM023219.2
chromosome length 95772356
location 10683211 ~ 10683506 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU11189
ggggcactatttttatttttggaaaaataacgttcccaaagtaaacagcctatttctcaggaccagatgctagaatctgcatataattgacagcttaggatagaaaacactctaaagtttccaaaactgtaaaaatattgtctgtgagtataacagaactgatattgcaggcgaaagcctgagaaaaatccaatcaggaagtgactcttattttgaaactattgtgttcctatgcatccctattgaccattgaaagggatatcaaccagattcctttttctatgatttccctaagg

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU11189 True 296 lncRNA 0.42 1 10683211 10683506

Neighbor


gene id symbol gene type direction distance location
gipc3 LOC106574151 coding upstream 520263 10140230 ~ 10162948 (+)
lim2.2 LOC106574149 coding upstream 575323 10104169 ~ 10107888 (+)
asb3 LOC106574148 coding upstream 581574 10096943 ~ 10101637 (+)
ftsj3 ftsj3 coding upstream 586454 10087300 ~ 10096757 (+)
LOC110533060 gnb4 coding upstream 634534 10012701 ~ 10048677 (+)
LOC110523899 LOC106574090 coding downstream 749596 11433102 ~ 11514427 (+)
LOC110534079 LOC106574089 coding downstream 981102 11664608 ~ 11666692 (+)
ccdc50 ccd50 coding downstream 1162213 11845719 ~ 11879266 (+)
LOC110534540 LOC106574080 coding downstream 1220185 11903691 ~ 11906713 (+)
LOC110534688 LOC106573995 coding downstream 1239070 11922576 ~ 12025076 (+)
G8871 NA non-coding upstream 11924 10617229 ~ 10671287 (+)
G8846 NA non-coding upstream 120884 10561144 ~ 10562327 (+)
G8764 NA non-coding upstream 262675 10417343 ~ 10420536 (+)
G8695 NA non-coding upstream 382023 10299882 ~ 10301188 (+)
G8652 NA non-coding upstream 458600 10222257 ~ 10224611 (+)
G9242 NA non-coding downstream 156 10683662 ~ 10684007 (+)
G9249 NA non-coding downstream 6819 10690325 ~ 10690524 (+)
G9273 NA non-coding downstream 22716 10706222 ~ 10706442 (+)
G9307 NA non-coding downstream 50264 10733770 ~ 10733980 (+)
G9315 NA non-coding downstream 56042 10739548 ~ 10739759 (+)
LOC110510920 LOC106574155 other upstream 691669 9980527 ~ 9991542 (+)
LOC118966784 LOC106574127 other upstream 1223258 9450932 ~ 9460358 (+)
LOC110505168 LOC106574179 other upstream 2427333 8255142 ~ 8271732 (+)
LOC110501328 LOC106574178 other upstream 2452976 8229189 ~ 8231566 (+)
LOC110538561 LOC106574035 other downstream 2555107 13238613 ~ 13295452 (+)
G12410 NA other downstream 2945357 13617059 ~ 13666871 (+)
LOC110486057 NA other downstream 3508950 14192456 ~ 14214939 (+)
G13380 NA other downstream 3995844 14679350 ~ 14679578 (+)

Expression


G9241 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 25.
End of interactive chart.

G9241 Expression in each Bioproject

Bar chart with 20 bars.
G9241 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 750.
End of interactive chart.

Co-expression Network