G10236



Basic Information


Item Value
gene id G10236
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048565.1
NCBI id CM023219.2
chromosome length 95772356
location 11541739 ~ 11542096 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU12239
ggtcaataacaaaagtttatctcaatactttgttatataccctttgttggcaatgacagaggtcaaacgttttctgtaagtcttcacaaggttttcacacactgttgctggtattttggcccattcctccatgcatatctcctctagagcagtgatgttttggggctgttgctgggcaacacagactttcaactccctccaaagattttctatggggttgagatctggagactggctaggccactccaggaccttgaaatgcttcttacgaagccactccttcattgcccgggcgatgtgtttgggatcattgtcatgctgaaagacccagccacgtttcatcttcaatgcccttgct

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU12239 True 358 lncRNA 0.51 1 11541739 11542096

Neighbor


gene id symbol gene type direction distance location
LOC110523899 LOC106574090 coding upstream 27312 11433102 ~ 11514427 (+)
gipc3 LOC106574151 coding upstream 1378791 10140230 ~ 10162948 (+)
lim2.2 LOC106574149 coding upstream 1433851 10104169 ~ 10107888 (+)
asb3 LOC106574148 coding upstream 1440102 10096943 ~ 10101637 (+)
ftsj3 ftsj3 coding upstream 1444982 10087300 ~ 10096757 (+)
LOC110534079 LOC106574089 coding downstream 122512 11664608 ~ 11666692 (+)
ccdc50 ccd50 coding downstream 303623 11845719 ~ 11879266 (+)
LOC110534540 LOC106574080 coding downstream 361595 11903691 ~ 11906713 (+)
LOC110534688 LOC106573995 coding downstream 380480 11922576 ~ 12025076 (+)
cpox LOC106573996 coding downstream 495629 12037725 ~ 12043817 (+)
G10226 NA non-coding upstream 3976 11537392 ~ 11537763 (+)
G10223 NA non-coding upstream 7203 11534301 ~ 11534536 (+)
G10208 NA non-coding upstream 26325 11515185 ~ 11515414 (+)
G9980 NA non-coding upstream 164941 11375423 ~ 11376798 (+)
G9970 LOC106574093 non-coding upstream 180901 11359287 ~ 11360838 (+)
G10241 NA non-coding downstream 2607 11544703 ~ 11544905 (+)
G10247 NA non-coding downstream 7461 11549557 ~ 11549791 (+)
G10265 NA non-coding downstream 21461 11563557 ~ 11563781 (+)
G10277 NA non-coding downstream 30768 11572864 ~ 11573437 (+)
G10313 NA non-coding downstream 79196 11621292 ~ 11621566 (+)
LOC110510920 LOC106574155 other upstream 1550197 9980527 ~ 9991542 (+)
LOC118966784 LOC106574127 other upstream 2081786 9450932 ~ 9460358 (+)
LOC110505168 LOC106574179 other upstream 3285861 8255142 ~ 8271732 (+)
LOC110538561 LOC106574035 other downstream 1696517 13238613 ~ 13295452 (+)
G12410 NA other downstream 2086767 13617059 ~ 13666871 (+)
LOC110486057 NA other downstream 2650360 14192456 ~ 14214939 (+)
G13380 NA other downstream 3137254 14679350 ~ 14679578 (+)
G13381 NA other downstream 3137602 14679698 ~ 14680027 (+)

Expression


G10236 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 30.
End of interactive chart.

G10236 Expression in each Bioproject

Bar chart with 21 bars.
G10236 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 750.
End of interactive chart.

Co-expression Network