G12412



Basic Information


Item Value
gene id G12412
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048565.1
NCBI id CM023219.2
chromosome length 95772356
location 13629753 ~ 13665236 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU14712
gagaaagcgagaacggggaaggagagagagcgagagaaagagagaacagggaaggagagagagcgagagagagaacggggaaggagagagagcgagagaaagagagaacggggaaggagagagagcgagagaaagagagaacggggaaggagagagagcgagagaaagagagaacggggagggagagagagcgagagaaag

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU14712 True 201 lncRNA 0.67 2 13629753 13665236

Neighbor


gene id symbol gene type direction distance location
pdzk1ip1 LOC106574040 coding upstream 188225 13436016 ~ 13441528 (+)
LOC110485322 LOC106574039 coding upstream 198636 13425566 ~ 13431117 (+)
LOC110485223 LOC106574083 coding upstream 218463 13409282 ~ 13411290 (+)
LOC110538561 LOC106574035 coding upstream 334301 13238613 ~ 13295452 (+)
LOC110526761 LOC106574030 coding upstream 405850 13214771 ~ 13223903 (+)
tm2d1 LOC106574044 coding downstream 69527 13734763 ~ 13753675 (+)
LOC110508285 LOC106574085 coding downstream 475260 14140496 ~ 14144946 (+)
LOC110485648 LOC106574045 coding downstream 497149 14162385 ~ 14171600 (+)
LOC110485979 LOC106574047 coding downstream 507283 14172519 ~ 14185257 (+)
LOC110486057 NA coding downstream 527231 14192456 ~ 14214939 (+)
G12396 NA non-coding upstream 43850 13585704 ~ 13585903 (+)
G12390 NA non-coding upstream 48443 13581105 ~ 13581310 (+)
G12371 NA non-coding upstream 70175 13559335 ~ 13559578 (+)
G12368 NA non-coding upstream 72146 13557369 ~ 13557607 (+)
G12367 NA non-coding upstream 72617 13556927 ~ 13557136 (+)
G12497 NA non-coding downstream 110297 13775533 ~ 13775871 (+)
G12499 NA non-coding downstream 114371 13779607 ~ 13788862 (+)
G12504 NA non-coding downstream 130699 13795935 ~ 13799297 (+)
G12509 NA non-coding downstream 146700 13811936 ~ 13813273 (+)
G12535 NA non-coding downstream 188255 13853491 ~ 13853770 (+)
LOC110523899 LOC106574090 other upstream 2115371 11433102 ~ 11514427 (+)
gipc3 LOC106574151 other upstream 3468467 10140230 ~ 10162948 (+)
LOC110510920 LOC106574155 other upstream 3638211 9980527 ~ 9991542 (+)
LOC118966784 LOC106574127 other upstream 4169800 9450932 ~ 9460358 (+)
G13380 NA other downstream 1014114 14679350 ~ 14679578 (+)
G13381 NA other downstream 1014462 14679698 ~ 14680027 (+)
G13391 NA other downstream 1034940 14700176 ~ 14700730 (+)
G13434 NA other downstream 1146535 14811771 ~ 14812624 (+)

Expression


G12412 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 500.
End of interactive chart.

G12412 Expression in each Bioproject

Bar chart with 8 bars.
G12412 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 10000.
End of interactive chart.

Co-expression Network