G12845



Basic Information


Item Value
gene id G12845
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048565.1
NCBI id CM023219.2
chromosome length 95772356
location 13863817 ~ 13865471 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU15235
acggtacagagtcaatgtggaggctatatacagggtgttacggtacagagtcaatgtggaggctatatacagggtgttacggtacagagtcaatgtggatgctatatacagggtgttacggtacagagtcaatgtggatgctatatacagggtgttacggtacagagtcaatgtggaggctatatacagggtgttacggtacagagtcaatgtggaggctatatacagggtgttacggtacagagtcaatgtggaggctatatacagggtgttacggtacagagtcaatgtggaggctatatacagggtgttacggtacagagtcaatgtggatgctatatacagggggtaccggtacagagtcaatgtggaggctatatacagggtgttacggtacagagtcaatgtggaggctatatacagggtgttacggtacagagtcaatgtggaggctatatacagggggtaccagtacagagtcaatgtggaggctatatacagggtgttacggtacagagtcaatgtggaggctatatacagggtgttacggtacagagtcaatgtggaggctatatacagggtgttacggtacagaggcaatgtggaggctatatacagggtgttacggtacagaggcaatgtg

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU15235 True 643 TUCP 0.51 2 13863817 13865471

Neighbor


gene id symbol gene type direction distance location
LOC110527678 LOC106574041 coding downstream 128496 13592909 ~ 13735321 (-)
LOC118939516 LOC106574041 coding downstream 278259 13568174 ~ 13585743 (-)
LOC110511200 LOC106574043 coding downstream 332627 13443706 ~ 13531190 (-)
LOC110485093 LOC106574038 coding downstream 466087 13353042 ~ 13397730 (-)
LOC110539125 LOC106574037 coding downstream 511056 13307331 ~ 13352761 (-)
LOC110486121 LOC106574050 coding upstream 349958 14215429 ~ 14218286 (-)
LOC110486637 LOC106574056 coding upstream 629339 14494810 ~ 14529940 (-)
LOC110486932 LOC106574064 coding upstream 771724 14637195 ~ 14858563 (-)
LOC110487385 LOC106574065 coding upstream 1090479 14955950 ~ 14959313 (-)
LOC110487509 LOC106574066 coding upstream 1097928 14962746 ~ 14988503 (-)
G12826 NA non-coding downstream 247 13840266 ~ 13863570 (-)
G12810 NA non-coding downstream 38938 13807951 ~ 13824879 (-)
LOC110485551 nfia non-coding downstream 76942 13784306 ~ 14089464 (-)
G12760 NA non-coding downstream 126590 13734788 ~ 13737227 (-)
G12894 NA non-coding upstream 89242 13954713 ~ 13955100 (-)
G12897 NA non-coding upstream 92525 13957996 ~ 13958357 (-)
G12953 NA non-coding upstream 180937 14046408 ~ 14046646 (-)
G12954 NA non-coding upstream 184829 14050300 ~ 14050567 (-)
G12966 NA non-coding upstream 201016 14066487 ~ 14066705 (-)
G12196 NA other downstream 568364 13293405 ~ 13295453 (-)
G12173 LOC106574030 other downstream 643483 13219837 ~ 13220334 (-)
G11194 NA other downstream 1448145 12415365 ~ 12415672 (-)
G11037 LOC106574005 other downstream 1594031 12269520 ~ 12269786 (-)
G13000 NA other upstream 276409 14141880 ~ 14173343 (-)
G13195 fam163a other upstream 481611 14347082 ~ 14349478 (-)
G13196 LOC106574055 other upstream 500819 14366290 ~ 14368501 (-)
G14120 antithrombin other upstream 1300710 15114926 ~ 15174030 (-)

Expression


G12845 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 30.
End of interactive chart.

G12845 Expression in each Bioproject

Bar chart with 20 bars.
G12845 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1000.
End of interactive chart.

Co-expression Network