G17601



Basic Information


Item Value
gene id G17601
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048565.1
NCBI id CM023219.2
chromosome length 95772356
location 19048022 ~ 19048280 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU20611
ggttggaaccaaaaatctccaatttggactccagaccaaaggacagatttccaccggtctaatgtccattgctaatgtttcttggcccaagcaagtcttcttcttattggtgtcctttagtagtggtttctttgcagcaattctaccatgaaggcctgattctcacagtctcctctgaacagttgatgttgagatgtgtctgttacttgaactttgtgaagcatttatttgggctgcaatttgtgaggctggtaactct

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU20611 True 259 lncRNA 0.48 1 19048022 19048280
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110500307 LOC106573820 coding upstream 6055 19024216 ~ 19041967 (+)
LOC110500236 LOC106573821 coding upstream 75836 18957927 ~ 18972186 (+)
LOC110500115 LOC106573822 coding upstream 93977 18922258 ~ 18954045 (+)
LOC110499562 LOC106573826 coding upstream 169105 18859952 ~ 18878917 (+)
tnfaip8l1 LOC106573828 coding upstream 195068 18841198 ~ 18852954 (+)
LOC110500387 cherp coding downstream 4295 19052575 ~ 19064650 (+)
calr3a crt coding downstream 20712 19068992 ~ 19076771 (+)
rad23ab LOC106573817 coding downstream 28544 19076824 ~ 19084655 (+)
eps15l1a eps15l1 coding downstream 42945 19091225 ~ 19121925 (+)
mrpl54 LOC106573541 coding downstream 300892 19349172 ~ 19351119 (+)
G17564 NA non-coding upstream 2149 19043419 ~ 19045873 (+)
G17576 NA non-coding upstream 38892 19008891 ~ 19009130 (+)
G17567 NA non-coding upstream 48719 18999100 ~ 18999303 (+)
G17566 NA non-coding upstream 53416 18994217 ~ 18994606 (+)
G17561 NA non-coding upstream 56950 18990811 ~ 18991072 (+)
G17605 NA non-coding downstream 31999 19080279 ~ 19080491 (+)
G17606 NA non-coding downstream 32605 19080885 ~ 19081096 (+)
G17607 NA non-coding downstream 39622 19087902 ~ 19088231 (+)
G17615 NA non-coding downstream 64187 19112467 ~ 19112947 (+)
G17420 NA other upstream 91814 18882723 ~ 18956208 (+)
ccdc124 cc124 other upstream 1056846 17975918 ~ 17991176 (+)
LOC110495874 LOC106573877 other upstream 1383014 17654164 ~ 17673094 (+)
LOC110492876 LOC106613263 other upstream 2080232 16962997 ~ 16967790 (+)
LOC110492606 LOC106573909 other upstream 2127613 16916482 ~ 16920945 (+)
G18481 NA other downstream 516569 19564849 ~ 19565221 (+)
LOC110502506 LOC106573550 other downstream 520505 19568684 ~ 19575028 (+)
LOC110503939 LOC106573564 other downstream 815511 19863734 ~ 19865619 (+)
G19083 NA other downstream 867306 19915586 ~ 19915832 (+)
G19359 NA other downstream 1194365 20242645 ~ 20242875 (+)

Expression


G17601 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G17601 Expression in each Bioproject

Bar chart with 20 bars.
G17601 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network