G18281



Basic Information


Item Value
gene id G18281
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048565.1
NCBI id CM023219.2
chromosome length 95772356
location 19222749 ~ 19222978 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU21343
catggacactcttacagacagttgtggctgctttgcgtgacatattgtctctaccttcttgccctttgggctgttgtctgtgcccaataatgtttgtaccctgttctgtgctgctaccatgttgttgtcatgttgtgttgctaccatggtgtgttgtcatgtgttgctgccatgctatgttgttgtctctctttatgtaatgttgtgttgtctctcttgtcgttatgtgt

Function


NR:

description
PREDICTED: lys-63-specific deubiquitinase BRCC36-like isoform X2

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU21343 True 230 lncRNA 0.37 1 19222749 19222978

Neighbor


gene id symbol gene type direction distance location
eps15l1a eps15l1 coding upstream 100824 19091225 ~ 19121925 (+)
rad23ab LOC106573817 coding upstream 138094 19076824 ~ 19084655 (+)
calr3a crt coding upstream 145978 19068992 ~ 19076771 (+)
LOC110500387 cherp coding upstream 158099 19052575 ~ 19064650 (+)
LOC110500307 LOC106573820 coding upstream 180782 19024216 ~ 19041967 (+)
mrpl54 LOC106573541 coding downstream 126194 19349172 ~ 19351119 (+)
LOC110532010 LOC106613687 coding downstream 129112 19352090 ~ 19357017 (+)
LOC110501592 LOC106573542 coding downstream 136433 19359411 ~ 19368957 (+)
si:ch1073-396h14.1 LOC106573543 coding downstream 162006 19384984 ~ 19442316 (+)
tpm4a LOC106573547 coding downstream 287979 19510957 ~ 19536556 (+)
G17642 NA non-coding upstream 64583 19157912 ~ 19158166 (+)
G17640 NA non-coding upstream 66571 19155664 ~ 19156178 (+)
G17616 NA non-coding upstream 100164 19122252 ~ 19122585 (+)
G17615 NA non-coding upstream 109802 19112467 ~ 19112947 (+)
G18288 NA non-coding downstream 6823 19229801 ~ 19230019 (+)
G18341 NA non-coding downstream 85799 19308777 ~ 19308984 (+)
G18361 NA non-coding downstream 112532 19335510 ~ 19335916 (+)
G18364 NA non-coding downstream 114041 19337019 ~ 19339253 (+)
G18454 NA non-coding downstream 282545 19505523 ~ 19505847 (+)
G17420 NA other upstream 266541 18882723 ~ 18956208 (+)
ccdc124 cc124 other upstream 1231573 17975918 ~ 17991176 (+)
LOC110495874 LOC106573877 other upstream 1557741 17654164 ~ 17673094 (+)
LOC110492876 LOC106613263 other upstream 2254959 16962997 ~ 16967790 (+)
LOC110492606 LOC106573909 other upstream 2302340 16916482 ~ 16920945 (+)
G18481 NA other downstream 341871 19564849 ~ 19565221 (+)
LOC110502506 LOC106573550 other downstream 345807 19568684 ~ 19575028 (+)
LOC110503939 LOC106573564 other downstream 640813 19863734 ~ 19865619 (+)
G19083 NA other downstream 692608 19915586 ~ 19915832 (+)
G19359 NA other downstream 1019667 20242645 ~ 20242875 (+)

Expression


G18281 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G18281 Expression in each Bioproject

Bar chart with 9 bars.
G18281 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 20.
End of interactive chart.

Co-expression Network