G19006



Basic Information


Item Value
gene id G19006
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048565.1
NCBI id CM023219.2
chromosome length 95772356
location 19814783 ~ 19815136 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU22132
ACAGTTTTCCATGTCTCTTTAATGACGTTCCTACTCGCACAAACGTGTTGGAACATGACATTAATGTTGGAAATGCTACACCTATCAAGCAACACCCATATCGTATCAACGCTTCCAAGAGGAAGATAATGAGGGATGAGGTGAAATATTTGTTGGAGAATGACCTGGCTACGCCAAGTTCCAGCCCTTGGAGTTCTCCTTGCATTCTGGTTCCTAAACCTGATGGTACGTCCAGGTTATGTACGGATTATCGAAAGGTAAATTCTGTCACAATGCCAGATTCGTTCCCGTTACCCAGACTGGACGACTGTATCGACACTATTGGTGCTGCTAAGTATGTAACTAAGTTGGACC

Function


NR:

description
PREDICTED: uncharacterized protein LOC106585798

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU22132 True 354 lncRNA 0.47 1 19814783 19815136

Neighbor


gene id symbol gene type direction distance location
LOC110503352 LOC106573557 coding downstream 71142 19732869 ~ 19743641 (-)
LOC110502937 ccl25 coding downstream 181725 19630376 ~ 19633058 (-)
LOC110502819 dpoe4 coding downstream 194589 19605164 ~ 19620194 (-)
LOC110502382 LOC106573549 coding downstream 276001 19536427 ~ 19538782 (-)
LOC110501969 LOC106573546 coding downstream 331460 19474588 ~ 19483323 (-)
LOC110503449 LOC106611608 coding upstream 14189 19829325 ~ 19832397 (-)
LOC110503510 nduab coding upstream 21137 19836273 ~ 19838863 (-)
larp6b LOC106573560 coding upstream 26385 19841521 ~ 19844225 (-)
tmprss9 tmprss9 coding upstream 50746 19865882 ~ 19890280 (-)
LOC110504151 NA coding upstream 104429 19919565 ~ 19934801 (-)
G19004 NA non-coding downstream 2534 19811972 ~ 19812249 (-)
G18981 NA non-coding downstream 5483 19776997 ~ 19809300 (-)
G18966 NA non-coding downstream 62973 19751457 ~ 19751810 (-)
G18960 NA non-coding downstream 71642 19742852 ~ 19743141 (-)
G18922 NA non-coding downstream 124590 19689929 ~ 19690193 (-)
G19015 NA non-coding upstream 13690 19828826 ~ 19829049 (-)
G19030 LOC106573562 non-coding upstream 24701 19839837 ~ 19841484 (-)
G19032 NA non-coding upstream 30496 19845632 ~ 19845952 (-)
G19034 NA non-coding upstream 38989 19854125 ~ 19854347 (-)
G19038 NA non-coding upstream 41833 19856969 ~ 19857241 (-)
mydgf LOC106573827 other downstream 929131 18876547 ~ 18888907 (-)
LOC110497762 LOC106573859 other downstream 1419923 18390123 ~ 18450517 (-)
LOC110497564 LOC106573866 other downstream 1719845 18089520 ~ 18098678 (-)
G16161 LOC106573901 other downstream 2557542 17255236 ~ 17257241 (-)
G20266 NA other upstream 983984 20799120 ~ 20800008 (-)
LOC118945319 NA other upstream 1270162 21085298 ~ 21089250 (-)
LOC110507736 LOC106573601 other upstream 1720797 21535882 ~ 21565723 (-)
G21993 NA other upstream 2566734 22381870 ~ 22382208 (-)
G22350 LOC106573623 other upstream 3024709 22839845 ~ 22843305 (-)

Expression


G19006 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G19006 Expression in each Bioproject

Bar chart with 17 bars.
G19006 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network