G20423



Basic Information


Item Value
gene id G20423
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048565.1
NCBI id CM023219.2
chromosome length 95772356
location 21094323 ~ 21094522 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU23844
ctgaatataacatacacctttagtagtctgaatataatatacacctttaatagtctgaatataacatacacctttaatcgtctgaatatatcatacacctttaatattctgaatatatcatacacctttaatattctgaatataatatacacctttaataatctgaatataatatacacctttaattttctgaatatatc

Function


NR:

description
A disintegrin and metalloproteinase with thrombospondin motifs 6-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU23844 True 200 lncRNA 0.33 1 21094323 21094522

Neighbor


gene id symbol gene type direction distance location
LOC118945319 NA coding downstream 5147 21085298 ~ 21089250 (-)
LOC110532071 LOC106573588 coding downstream 89114 20988056 ~ 21005209 (-)
tmem221 LOC106573585 coding downstream 161871 20927809 ~ 20932452 (-)
rfxank rfxank coding downstream 171390 20919626 ~ 20922933 (-)
LOC110506380 NA coding downstream 192284 20885537 ~ 20902039 (-)
LOC110507379 LOC106573593 coding upstream 33665 21128187 ~ 21133777 (-)
LOC110511465 LOC106573796 coding upstream 97822 21192344 ~ 21193157 (-)
LOC118945781 NA coding upstream 138260 21232782 ~ 21242022 (-)
LOC110507674 LOC105011525 coding upstream 263213 21357735 ~ 21362790 (-)
cirbp LOC106573597 coding upstream 268470 21362992 ~ 21368888 (-)
G20419 NA non-coding downstream 14239 21074899 ~ 21080084 (-)
G20307 NA non-coding downstream 231130 20862022 ~ 20863193 (-)
G20299 NA non-coding downstream 241440 20852451 ~ 20852883 (-)
G20273 NA non-coding downstream 284738 20809355 ~ 20809585 (-)
G20425 NA non-coding upstream 26380 21120902 ~ 21121351 (-)
G20456 LOC106573594 non-coding upstream 79962 21174484 ~ 21175171 (-)
G20557 NA non-coding upstream 216283 21310805 ~ 21312539 (-)
G20666 NA non-coding upstream 262686 21357208 ~ 21357457 (-)
G20668 NA non-coding upstream 276242 21370764 ~ 21371028 (-)
G20266 NA other downstream 294315 20799120 ~ 20800008 (-)
LOC110502937 ccl25 other downstream 1461706 19630376 ~ 19633058 (-)
mydgf LOC106573827 other downstream 2208671 18876547 ~ 18888907 (-)
LOC110497762 LOC106573859 other downstream 2699463 18390123 ~ 18450517 (-)
LOC110507736 LOC106573601 other upstream 441411 21535882 ~ 21565723 (-)
G21993 NA other upstream 1287348 22381870 ~ 22382208 (-)
G22350 LOC106573623 other upstream 1745323 22839845 ~ 22843305 (-)
G23394 NA other upstream 2529504 23624026 ~ 23624349 (-)
LOC110511130 LOC106573631 other upstream 2728178 23821656 ~ 23861029 (-)

Expression



Co-expression Network