G33284



Basic Information


Item Value
gene id G33284
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048565.1
NCBI id CM023219.2
chromosome length 95772356
location 31956530 ~ 31961547 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU37697
gtgaatgaggacccaaaagcgacttaacgtaaacagagcttctttaatagcaaaacaaacgtaggctcagatggaccggcagattccgacaggacaggacaaggttgcagcaaacatgacgatagtctggttcaggcatgaacaacacaaacaagaatccgacaaagacaggagcagaaacagagagagatatagaggactaatcagagggaaaaagggaacaggtgggaaaaggggtaacgaggtagttaggaggagacaaggcacagctggggaaaagagggggagaaaaggtaacctaacacgaccagcagagggagacagggtgaaaggaaaggacagaaacaagacacaacatgacaa

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU37697 True 363 TUCP 0.51 2 31956530 31961547
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110521218 LOC106573489 coding upstream 174335 31668656 ~ 31782195 (+)
trnah-gug NA coding upstream 288955 31667504 ~ 31667575 (+)
LOC110521202 LOC105025677 coding upstream 294383 31639629 ~ 31662147 (+)
LOC110532186 LOC106561197 coding upstream 358308 31597365 ~ 31598222 (+)
LOC110521117 LOC106573496 coding upstream 393259 31553090 ~ 31563271 (+)
LOC110520271 LOC106573485 coding downstream 3017 31964564 ~ 31966876 (+)
LOC110521263 idhp coding downstream 18738 31980285 ~ 31989249 (+)
LOC110521304 LOC106573467 coding downstream 137662 32099209 ~ 32204312 (+)
zgc:162879 LOC106573468 coding downstream 242928 32204475 ~ 32215553 (+)
LOC110521325 LOC106573469 coding downstream 307507 32269054 ~ 32318545 (+)
G33258 NA non-coding upstream 99852 31856372 ~ 31856678 (+)
G33251 NA non-coding upstream 105055 31851219 ~ 31851475 (+)
G33247 NA non-coding upstream 107555 31848741 ~ 31848975 (+)
G32774 LOC106561174 non-coding upstream 123898 31832209 ~ 31832632 (+)
G32748 NA non-coding upstream 157499 31798384 ~ 31799031 (+)
G33334 NA non-coding downstream 6516 31968063 ~ 31968385 (+)
G33432 NA non-coding downstream 40843 32002390 ~ 32002823 (+)
G33576 NA non-coding downstream 247376 32208923 ~ 32209125 (+)
G33474 NA non-coding downstream 255603 32217150 ~ 32217924 (+)
G33484 NA non-coding downstream 257902 32219449 ~ 32225528 (+)
G33249 NA other upstream 105561 31850473 ~ 31850969 (+)
mef2aa mef2a other upstream 2703312 29188958 ~ 29316547 (+)
LOC110520661 LOC106573762 other upstream 2888735 28903691 ~ 29067795 (+)
G28416 carmil2 other upstream 3908168 28047626 ~ 28048362 (+)
G28285 LOC106573733 other upstream 4101576 27853757 ~ 27854954 (+)
G33681 LOC106573476 other downstream 489307 32450854 ~ 32452385 (+)
G33768 NA other downstream 651526 32613073 ~ 32617684 (+)
sema3e LOC106573450 other downstream 1361220 33268524 ~ 33326523 (+)
LOC118964465 LOC106573449 other downstream 1430176 33371468 ~ 33402776 (+)
G34963 NA other downstream 1740230 33701777 ~ 33703462 (+)

Expression


G33284 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G33284 Expression in each Bioproject

Bar chart with 19 bars.
G33284 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.

Co-expression Network