G33576



Basic Information


Item Value
gene id G33576
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048565.1
NCBI id CM023219.2
chromosome length 95772356
location 32208923 ~ 32209125 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU38003
atttggggagttgctcccattcttctttgcagatcttctcaagctctgtctggttggatagggagcatcactgcacagctattttcagccctccagagatgttcgatcaggttcaagtccgggctttggctgggccactcaaggacattcagagacttgtcccaaagccactcctgcattttcttggctgtgtgcttagggtc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU38003 True 203 lncRNA 0.45 1 32208923 32209125

Neighbor


gene id symbol gene type direction distance location
LOC110521304 LOC106573467 coding upstream 4611 32099209 ~ 32204312 (+)
LOC110521263 idhp coding upstream 219674 31980285 ~ 31989249 (+)
LOC110520271 LOC106573485 coding upstream 242047 31964564 ~ 31966876 (+)
LOC110521218 LOC106573489 coding upstream 426728 31668656 ~ 31782195 (+)
trnah-gug NA coding upstream 541348 31667504 ~ 31667575 (+)
LOC110521325 LOC106573469 coding downstream 59929 32269054 ~ 32318545 (+)
si:dkey-30c15.2 LOC106573475 coding downstream 144243 32353368 ~ 32360898 (+)
terb1 LOC106573465 coding downstream 227781 32436906 ~ 32446878 (+)
si:dkey-30c15.13 LOC106573478 coding downstream 272337 32481462 ~ 32485466 (+)
LOC110521454 LOC106573411 coding downstream 524394 32733519 ~ 32751025 (+)
G33432 NA non-coding upstream 206100 32002390 ~ 32002823 (+)
G33334 NA non-coding upstream 240538 31968063 ~ 31968385 (+)
G33258 NA non-coding upstream 352245 31856372 ~ 31856678 (+)
G33251 NA non-coding upstream 357448 31851219 ~ 31851475 (+)
G33247 NA non-coding upstream 359948 31848741 ~ 31848975 (+)
G33474 NA non-coding downstream 8025 32217150 ~ 32217924 (+)
G33484 NA non-coding downstream 10324 32219449 ~ 32225528 (+)
G33606 NA non-coding downstream 64189 32273314 ~ 32273520 (+)
G33471 NA non-coding downstream 69322 32278447 ~ 32333634 (+)
G33478 NA non-coding downstream 133740 32342865 ~ 32345335 (+)
G33284 NA other upstream 247376 31956530 ~ 31961547 (+)
G33249 NA other upstream 357954 31850473 ~ 31850969 (+)
mef2aa mef2a other upstream 2955705 29188958 ~ 29316547 (+)
LOC110520661 LOC106573762 other upstream 3141128 28903691 ~ 29067795 (+)
G28416 carmil2 other upstream 4160561 28047626 ~ 28048362 (+)
G33681 LOC106573476 other downstream 241729 32450854 ~ 32452385 (+)
G33768 NA other downstream 403948 32613073 ~ 32617684 (+)
sema3e LOC106573450 other downstream 1113642 33268524 ~ 33326523 (+)
LOC118964465 LOC106573449 other downstream 1182598 33371468 ~ 33402776 (+)
G34963 NA other downstream 1492652 33701777 ~ 33703462 (+)

Expression


G33576 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G33576 Expression in each Bioproject

Bar chart with 13 bars.
G33576 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 50.
End of interactive chart.

Co-expression Network