G35964



Basic Information


Item Value
gene id G35964
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048565.1
NCBI id CM023219.2
chromosome length 95772356
location 33938838 ~ 33939050 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU40656
gtcggaactagaagcacaagcatttcgctacactcgcattaacatctgctaaccatgtgtacagtggggcaaaaaagtatttagtcagccaccaattgtgcaagttctcccacttaaaaagatgagagaggcctgtaattttcattataggcacacttcaactacgacagaaaaaatgagaaaaaaaatccagaaaatcgcattgtaggattt

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU40656 True 213 lncRNA 0.39 1 33938838 33939050

Neighbor


gene id symbol gene type direction distance location
lrrc4.2 LOC106573446 coding downstream 208872 33724849 ~ 33729966 (-)
grm3 LOC106573453 coding downstream 1014239 32867631 ~ 32924599 (-)
LOC118964459 NA coding downstream 1094106 32839445 ~ 32844732 (-)
LOC110521494 LOC106573457 coding downstream 1154859 32761197 ~ 32783979 (-)
LOC110532201 LOC106573459 coding downstream 1204389 32530266 ~ 32734449 (-)
rbm28 rbm28 coding upstream 5784 33944834 ~ 33953935 (-)
LOC118966666 LOC106573442 coding upstream 20278 33959328 ~ 33962096 (-)
LOC110521614 LOC106573524 coding upstream 44327 33983377 ~ 34002282 (-)
si:ch1073-390k14.1 LOC106573523 coding upstream 70230 34009280 ~ 34018443 (-)
LOC110521650 LOC106573438 coding upstream 86135 34025185 ~ 34040439 (-)
G35961 NA non-coding downstream 2370 33936214 ~ 33936468 (-)
G35960 NA non-coding downstream 2677 33935889 ~ 33936161 (-)
G35958 NA non-coding downstream 5579 33933021 ~ 33933259 (-)
G35586 NA non-coding downstream 73147 33805191 ~ 33865691 (-)
G35966 NA non-coding upstream 3676 33942726 ~ 33942972 (-)
G35968 NA non-coding upstream 15451 33954501 ~ 33955468 (-)
G35979 NA non-coding upstream 29007 33968057 ~ 33968349 (-)
G35969 LOC106573441 non-coding upstream 30140 33969190 ~ 33970767 (-)
G35982 NA non-coding upstream 34456 33973506 ~ 33973779 (-)
G35628 NA other downstream 70793 33867558 ~ 33868045 (-)
G35299 NA other downstream 486425 33442368 ~ 33452413 (-)
G35075 LOC106573452 other downstream 830341 33107119 ~ 33108497 (-)
G33386 NA other downstream 1952688 31984771 ~ 31989249 (-)
LOC110521048 LOC100194695 other downstream 2493889 31426123 ~ 31444964 (-)
G36141 NA other upstream 338650 34277700 ~ 34362736 (-)
G36196 NA other upstream 402512 34341562 ~ 34381232 (-)
G37310 LOC106573403 other upstream 1334659 35273709 ~ 35278005 (-)
G37907 NA other upstream 1501868 35440918 ~ 35441328 (-)
G37976 NA other upstream 1644242 35583292 ~ 35583608 (-)

Expression


G35964 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G35964 Expression in each Bioproject

Bar chart with 10 bars.
G35964 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network