G35694



Basic Information


Item Value
gene id G35694
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048565.1
NCBI id CM023219.2
chromosome length 95772356
location 33943411 ~ 33943650 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU40340
agtccatagcatcaacgccttcctcttgcaggaactgctgacacactccagccacatgaggtctagcattgtcttgcattaggaggaacccagggccaaccgcaccagcatatggtctcacaaggggtctgaggatctcatctcggtacctaatggcagtcaggctacctctggcgagcacatggagggctgtgcggccccccaaagaaatgccaccccacaccatgactgacccaccgc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU40340 True 240 lncRNA 0.57 1 33943411 33943650
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110521571 LOC106573447 coding upstream 293644 33622869 ~ 33649767 (+)
LOC110521553 LOC106573448 coding upstream 346741 33534145 ~ 33596670 (+)
LOC110521560 LOC106573448 coding upstream 421743 33498661 ~ 33521668 (+)
LOC110532225 LOC106573449 coding upstream 462047 33421518 ~ 33481364 (+)
LOC118964465 LOC106573449 coding upstream 540635 33371468 ~ 33402776 (+)
LOC110521608 LOC106573441 coding downstream 24100 33967750 ~ 33977868 (+)
LOC110521627 LOC106573440 coding downstream 60530 34004180 ~ 34006028 (+)
LOC110521655 LOC106573426 coding downstream 102597 34046247 ~ 34057828 (+)
calub LOC106573432 coding downstream 120721 34064371 ~ 34068111 (+)
LOC118966672 LOC106561218 coding downstream 125003 34068653 ~ 34071754 (+)
G35692 NA non-coding upstream 1580 33941527 ~ 33941831 (+)
G35691 NA non-coding upstream 2086 33941100 ~ 33941325 (+)
G35631 NA non-coding upstream 70983 33872211 ~ 33872428 (+)
G34879 NA non-coding upstream 382993 33560199 ~ 33560418 (+)
G34877 NA non-coding upstream 388942 33554223 ~ 33554469 (+)
G35697 NA non-coding downstream 6557 33950207 ~ 33950495 (+)
G35698 NA non-coding downstream 10810 33954460 ~ 33955542 (+)
G35705 NA non-coding downstream 21367 33965017 ~ 33965227 (+)
G35708 NA non-coding downstream 27516 33971166 ~ 33971518 (+)
G35711 NA non-coding downstream 29572 33973222 ~ 33973714 (+)
G34963 NA other upstream 239949 33701777 ~ 33703462 (+)
sema3e LOC106573450 other upstream 619806 33268524 ~ 33326523 (+)
G33768 NA other upstream 1325727 32613073 ~ 32617684 (+)
G33681 LOC106573476 other upstream 1491026 32450854 ~ 32452385 (+)
G35699 NA other downstream 14447 33958097 ~ 33958681 (+)
G35700 NA other downstream 16410 33960060 ~ 33960447 (+)
LOC110521835 LOC106573423 other downstream 546470 34490120 ~ 34507419 (+)
LOC110521947 LOC106573413 other downstream 820521 34763838 ~ 34808250 (+)
LOC110521950 LOC106573403 other downstream 1280874 35198681 ~ 35281121 (+)

Expression


G35694 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 200.
End of interactive chart.

G35694 Expression in each Bioproject

Bar chart with 21 bars.
G35694 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 4000.
End of interactive chart.

Co-expression Network