G39715



Basic Information


Item Value
gene id G39715
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048565.1
NCBI id CM023219.2
chromosome length 95772356
location 37422212 ~ 37422427 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU44845
acgttgtttagaatcaatcctcaaggtgtttttcaaatatctattcgataatctatcagtggtggcagctggcttctcatcagaaacaaatggaaaaatactgcagctagagattacgcaataattgcaacggaggacaccaagcgaccacctggtagatgtagtctcttatggtcaatcttccaatgatatgcctacaaatacgtcacaatgctg

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU44845 True 216 lncRNA 0.40 1 37422212 37422427
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110522323 LOC106573351 coding upstream 225564 37153473 ~ 37196648 (+)
LOC110522315 LOC106573352 coding upstream 292831 37071620 ~ 37129381 (+)
LOC110522265 LOC106573356 coding upstream 861758 36554747 ~ 36560454 (+)
phrf1 LOC106573357 coding upstream 883874 36518846 ~ 36538338 (+)
rassf7a LOC106573359 coding upstream 911081 36441437 ~ 36511131 (+)
LOC110522363 NA coding downstream 372015 37794442 ~ 37849251 (+)
LOC110522368 LOC106573348 coding downstream 621658 38044085 ~ 38191930 (+)
LOC118964578 NA coding downstream 894765 38317192 ~ 38319819 (+)
LOC110522396 LOC106573344 coding downstream 1700573 39123000 ~ 39294499 (+)
LOC110522413 LOC106573341 coding downstream 1914714 39337141 ~ 39339608 (+)
G39712 NA non-coding upstream 2060 37419890 ~ 37420152 (+)
G39710 NA non-coding upstream 2678 37419261 ~ 37419534 (+)
G39695 NA non-coding upstream 3418 37412801 ~ 37418794 (+)
G39700 NA non-coding upstream 9514 37412066 ~ 37412698 (+)
G39699 NA non-coding upstream 10605 37411387 ~ 37411607 (+)
G39778 NA non-coding downstream 54159 37476586 ~ 37476826 (+)
G39796 NA non-coding downstream 64766 37487193 ~ 37487476 (+)
G39815 NA non-coding downstream 80588 37503015 ~ 37503237 (+)
G39834 NA non-coding downstream 92525 37514952 ~ 37515248 (+)
G39844 NA non-coding downstream 100461 37522888 ~ 37523119 (+)
G38652 NA other upstream 538320 36842608 ~ 36883892 (+)
G37719 LOC106573365 other upstream 1278250 36141073 ~ 36143962 (+)
rad52 rad52 other upstream 1286358 36133477 ~ 36140940 (+)
LOC110522113 LOC106573380 other upstream 1483545 35922982 ~ 35938680 (+)
LOC110522073 LOC106573381 other upstream 1530605 35815461 ~ 35891607 (+)
G40149 LOC100136012 other downstream 348518 37770945 ~ 37771468 (+)
G40150 NA other downstream 349227 37771654 ~ 37772145 (+)
LOC110522455 LOC106573334 other downstream 1978736 39401145 ~ 39403331 (+)
LOC110520525 LOC106573323 other downstream 2214461 39636888 ~ 39645220 (+)
G42208 NA other downstream 2225111 39647538 ~ 39648632 (+)

Expression


G39715 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G39715 Expression in each Bioproject

Bar chart with 8 bars.
G39715 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.

Co-expression Network