G40079



Basic Information


Item Value
gene id G40079
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048565.1
NCBI id CM023219.2
chromosome length 95772356
location 37716540 ~ 37717033 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU45214
gttagtttgcttttgggtcctcattcactcaccataacagaagaatccgaccaagaatggacccagcgacttcggatcctctccactcagccgtcgggatccagggagcgatgctaggcagacacgagcaggaagtgtctgctgctcgacatgccgttgagaccctggccacccaagtctccaacctcacagaacaggttcaccatctccgcctcgatccaccggccacttccagggctttcgaatctccagagcccagaatcaataacccgccgtgttactctggggagcccactgaatgccgctcgttcctcacccagtgtgatattgtgttttctctccagcccaacacttactccaggagcactgctcgtgtcgcctacgtcatatctctccttattggacgggctcgtgagtggggcacggcaatctgggaggcaagggctgagtgtactaaccagtatcaagactttaaggaggagatgatacgggtt

Function


NR:

description
PREDICTED: protein LDOC1-like, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU45214 True 494 TUCP 0.55 1 37716540 37717033

Neighbor


gene id symbol gene type direction distance location
LOC118966689 NA coding downstream 22689 37688750 ~ 37693851 (-)
LOC118966688 NA coding downstream 28795 37682644 ~ 37687745 (-)
LOC118966685 NA coding downstream 34901 37676381 ~ 37681639 (-)
LOC118966683 NA coding downstream 41007 37670849 ~ 37675533 (-)
LOC110522348 LOC106573397 coding downstream 318906 37380568 ~ 37397634 (-)
LOC118964577 NA coding upstream 344056 38061089 ~ 38061663 (-)
LOC118964575 NA coding upstream 348926 38065959 ~ 38066761 (-)
LOC110520456 NA coding upstream 1298042 39015075 ~ 39019091 (-)
LOC110522389 LOC106573347 coding upstream 1363970 39081003 ~ 39084318 (-)
LOC118966691 LOC106573346 coding upstream 1383792 39100825 ~ 39115097 (-)
G40063 NA non-coding downstream 12528 37703779 ~ 37704012 (-)
G40049 NA non-coding downstream 24603 37685554 ~ 37691937 (-)
G39904 NA non-coding downstream 144680 37571522 ~ 37571860 (-)
G39857 NA non-coding downstream 182482 37533836 ~ 37534058 (-)
G40086 NA non-coding upstream 4914 37721947 ~ 37722176 (-)
G40133 NA non-coding upstream 40163 37757196 ~ 37757454 (-)
G40151 NA non-coding upstream 53952 37770985 ~ 37771257 (-)
G40160 NA non-coding upstream 59523 37776556 ~ 37776770 (-)
G40163 NA non-coding upstream 61522 37778555 ~ 37778860 (-)
G38855 NA other downstream 1205711 36508538 ~ 36510829 (-)
LOC110522187 LOC106573361 other downstream 1307521 36370091 ~ 36409064 (-)
G38045 LOC106573386 other downstream 1994484 35721440 ~ 35722056 (-)
G37976 NA other downstream 2132932 35583292 ~ 35583608 (-)
G37907 NA other downstream 2275212 35440918 ~ 35441328 (-)
G40732 NA other upstream 408247 38125280 ~ 38125725 (-)
G40768 LOC106573348 other upstream 470455 38187488 ~ 38191736 (-)
G41868 NA other upstream 1304772 39021805 ~ 39022025 (-)
tspan9a LOC106573177 other upstream 5321695 42852829 ~ 43129052 (-)
G49774 NA other upstream 8003772 45720805 ~ 45721124 (-)

Expression


G40079 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G40079 Expression in each Bioproject

Bar chart with 18 bars.
G40079 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network