G41844



Basic Information


Item Value
gene id G41844
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048565.1
NCBI id CM023219.2
chromosome length 95772356
location 39002131 ~ 39002349 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU47043
atcgagagcatcctgtcaggctgtatcgccgcctggtatggcaactgcaccgccctcaaccacaaggctctgcagagggtagtgcggtctgcacaacgcatcacccggggcaaactacctgccctccaggacacctacagcacccaatgtcacaggaaggccaaaaagataatcaaggacaacaaccacccaagccactgcctgttcaccccgctatca

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU47043 True 219 lncRNA 0.51 1 39002131 39002349

Neighbor


gene id symbol gene type direction distance location
LOC118964578 NA coding upstream 682312 38317192 ~ 38319819 (+)
LOC110522368 LOC106573348 coding upstream 810467 38044085 ~ 38191930 (+)
LOC110522363 NA coding upstream 1152880 37794442 ~ 37849251 (+)
LOC110522323 LOC106573351 coding upstream 1805483 37153473 ~ 37196648 (+)
LOC110522315 LOC106573352 coding upstream 1872750 37071620 ~ 37129381 (+)
LOC110522396 LOC106573344 coding downstream 120651 39123000 ~ 39294499 (+)
LOC110522413 LOC106573341 coding downstream 334792 39337141 ~ 39339608 (+)
unc45a unc45a coding downstream 340621 39342970 ~ 39352896 (+)
gdpgp1 gdpgp1 coding downstream 357404 39359753 ~ 39361427 (+)
agbl2 LOC106573336 coding downstream 370751 39373100 ~ 39391389 (+)
G41812 NA non-coding upstream 24040 38977867 ~ 38978091 (+)
G41525 NA non-coding upstream 236054 38765722 ~ 38766077 (+)
G41497 NA non-coding upstream 250259 38751653 ~ 38751872 (+)
G41401 NA non-coding upstream 321711 38680142 ~ 38680420 (+)
G41384 NA non-coding upstream 335132 38666784 ~ 38666999 (+)
G41860 NA non-coding downstream 14303 39016652 ~ 39017221 (+)
G41982 NA non-coding downstream 98313 39100662 ~ 39100869 (+)
G41984 NA non-coding downstream 99454 39101803 ~ 39102040 (+)
G41990 NA non-coding downstream 108472 39110821 ~ 39111031 (+)
G42163 NA non-coding downstream 474227 39476576 ~ 39476849 (+)
G40150 NA other upstream 1229986 37771654 ~ 37772145 (+)
G40149 LOC100136012 other upstream 1230663 37770945 ~ 37771468 (+)
G38652 NA other upstream 2118239 36842608 ~ 36883892 (+)
G37719 LOC106573365 other upstream 2858169 36141073 ~ 36143962 (+)
rad52 rad52 other upstream 2866277 36133477 ~ 36140940 (+)
LOC110522455 LOC106573334 other downstream 398814 39401145 ~ 39403331 (+)
LOC110520525 LOC106573323 other downstream 634539 39636888 ~ 39645220 (+)
G42208 NA other downstream 645189 39647538 ~ 39648632 (+)
LOC110522607 LOC106573315 other downstream 878747 39808863 ~ 39882239 (+)
G43208 NA other downstream 1098104 40100453 ~ 40101172 (+)

Expression


G41844 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 60.
End of interactive chart.

G41844 Expression in each Bioproject

Bar chart with 19 bars.
G41844 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1000.
End of interactive chart.

Co-expression Network