G48894



Basic Information


Item Value
gene id G48894
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048565.1
NCBI id CM023219.2
chromosome length 95772356
location 45062655 ~ 45062876 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU54626
aatgagtaaagggtctgaatacttatgtaaatatgacatttcatattttttgttttcataaatttgccaaaatggagaaaagtttttgctttgtcataatgggttattgtgtgtagattgatgagaggcggaaaaaaactatttcatccattttataaggctgtaacgtaacaaaattagcaaaaagtctaggggtctgtatactttccgaatgcactgtat

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU54626 True 222 lncRNA 0.48 1 45062655 45062876

Neighbor


gene id symbol gene type direction distance location
LOC110520774 NA coding downstream 161044 44900676 ~ 44901611 (-)
mmp15a LOC106573210 coding downstream 227169 44821497 ~ 44835486 (-)
LOC118960022 LOC106573206 coding downstream 245114 44816985 ~ 44817541 (-)
LOC110523630 LOC106561447 coding downstream 252275 44793384 ~ 44810380 (-)
lrrc29 LOC106573211 coding downstream 269823 44787137 ~ 44792832 (-)
LOC110523666 LOC106573213 coding upstream 53027 45115903 ~ 45142315 (-)
LOC110523718 LOC106573216 coding upstream 187138 45250014 ~ 45256049 (-)
LOC110523724 LOC106573217 coding upstream 194360 45257236 ~ 45299871 (-)
parvaa LOC106573218 coding upstream 241762 45304638 ~ 45321671 (-)
LOC110523755 NA coding upstream 263033 45325909 ~ 45414664 (-)
G48779 NA non-coding downstream 159550 44902783 ~ 44903105 (-)
G48746 NA non-coding downstream 202665 44859721 ~ 44859990 (-)
G48738 NA non-coding downstream 222101 44840228 ~ 44840554 (-)
G48736 NA non-coding downstream 223796 44837476 ~ 44838859 (-)
G48728 NA non-coding downstream 233669 44828366 ~ 44828986 (-)
G48907 NA non-coding upstream 6548 45069424 ~ 45069679 (-)
G49489 NA non-coding upstream 135730 45198606 ~ 45198941 (-)
G49510 NA non-coding upstream 157791 45220667 ~ 45220919 (-)
G49524 NA non-coding upstream 180897 45243773 ~ 45243993 (-)
tspan9a LOC106573177 other downstream 1933626 42852829 ~ 43129052 (-)
G41868 NA other downstream 6040630 39021805 ~ 39022025 (-)
G40768 LOC106573348 other downstream 6870919 38187488 ~ 38191736 (-)
G40732 NA other downstream 6936930 38125280 ~ 38125725 (-)
G40079 NA other downstream 7345622 37716540 ~ 37717033 (-)
G49774 NA other upstream 657929 45720805 ~ 45721124 (-)
G49962 NA other upstream 886082 45948958 ~ 45949951 (-)
G51214 NA other upstream 2001898 47064774 ~ 47236625 (-)
G51285 LOC106561952 other upstream 2226063 47288939 ~ 47289681 (-)
G51649 LOC106573246 other upstream 2314765 47377641 ~ 47378543 (-)

Expression


G48894 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G48894 Expression in each Bioproject

Bar chart with 2 bars.
G48894 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 35.
End of interactive chart.

Co-expression Network