G50926



Basic Information


Item Value
gene id G50926
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048565.1
NCBI id CM023219.2
chromosome length 95772356
location 46520583 ~ 46614421 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU56890
atcacagtgcaggtgcatttatacggagacttgattacacacaggtggattgtatttatcatcattagtcatttaggtcaacattggatcattcagagatcctcactgaacttctggagagagtttgctgcactgaaagtaaaggggctgaataattttgcacgcccaatttttcagttttgatttgttaaaaaagtttgaaatatccaataaatgtcgttccacttcatgattgtgtcccacttgttgttgattcttcacaaaaaaatacagttttatatc

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU56890 True 282 lncRNA 0.34 2 46520583 46614421

Neighbor


gene id symbol gene type direction distance location
tcp11l1 tcp11l1 coding downstream 423476 46085582 ~ 46097107 (-)
LOC110523921 LOC106573228 coding downstream 443842 46025778 ~ 46076741 (-)
LOC110523913 LOC106573227 coding downstream 495378 45987946 ~ 46025205 (-)
LOC110523903 LOC106573225 coding downstream 653485 45730235 ~ 45867098 (-)
LOC110523892 LOC106573278 coding downstream 839925 45632171 ~ 45680658 (-)
LOC110524015 LOC106573241 coding upstream 123014 46737435 ~ 46743033 (-)
LOC110524028 LOC106561496 coding upstream 202635 46817056 ~ 46839553 (-)
LOC118964698 NA coding upstream 286900 46901321 ~ 46902393 (-)
LOC118964697 NA coding upstream 331627 46946048 ~ 46947526 (-)
LOC118964694 NA coding upstream 358348 46972769 ~ 46974689 (-)
G50886 NA non-coding downstream 72886 46447460 ~ 46447697 (-)
G50883 NA non-coding downstream 76614 46443671 ~ 46443969 (-)
G50875 NA non-coding downstream 86088 46434228 ~ 46434495 (-)
G50831 NA non-coding downstream 157131 46363243 ~ 46363452 (-)
G50830 NA non-coding downstream 157736 46362636 ~ 46362847 (-)
G51091 NA non-coding upstream 149441 46763862 ~ 46764073 (-)
G51078 NA non-coding upstream 167345 46781766 ~ 46813577 (-)
G51038 NA non-coding upstream 184140 46798561 ~ 46805053 (-)
G51122 NA non-coding upstream 199533 46813954 ~ 46814375 (-)
G51123 NA non-coding upstream 200173 46814594 ~ 46814825 (-)
G49962 NA other downstream 570632 45948958 ~ 45949951 (-)
G49774 NA other downstream 799459 45720805 ~ 45721124 (-)
tspan9a LOC106573177 other downstream 3391554 42852829 ~ 43129052 (-)
G41868 NA other downstream 7498558 39021805 ~ 39022025 (-)
G40768 LOC106573348 other downstream 8328847 38187488 ~ 38191736 (-)
G51214 NA other upstream 450353 47064774 ~ 47236625 (-)
G51285 LOC106561952 other upstream 674518 47288939 ~ 47289681 (-)
G51649 LOC106573246 other upstream 763220 47377641 ~ 47378543 (-)
LOC110524104 LOC106573248 other upstream 927955 47541224 ~ 47561223 (-)
LOC110524264 LOC106573263 other upstream 1679687 48291626 ~ 48304829 (-)

Expression


G50926 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G50926 Expression in each Bioproject

Bar chart with 11 bars.
G50926 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network