G51193



Basic Information


Item Value
gene id G51193
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048565.1
NCBI id CM023219.2
chromosome length 95772356
location 47015304 ~ 47067386 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU57206
tcggtcatgtttccggttgccttgccatgattaaaagcagtggttcgcgttttcagttttgtgcgaatgctgccatcaatccatggtttctggttggggaaggttttaatagtcaccgtgggtacaacatcaccgatgcacttgctaataaactcgctcaccgaatcagcgtatacatcaatgttgttgtctgaggctatccggaacatatcccagtccacgtgatcgaagcaatcttgaagtgtggaatcagattggtcggaccagcattgaacagacctgagcacgggcgtttcctgttttagtttctgtctataggctgggagcaacaaaatcgagtcgtggtcagatttgcgactcgttaatcataagacatacacccccg

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU57206 True 385 lncRNA 0.47 2 47015304 47067386
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118964694 NA coding downstream 40615 46972769 ~ 46974689 (-)
LOC118964697 NA coding downstream 67778 46946048 ~ 46947526 (-)
LOC118964698 NA coding downstream 112911 46901321 ~ 46902393 (-)
LOC110524028 LOC106561496 coding downstream 175751 46817056 ~ 46839553 (-)
LOC110524015 LOC106573241 coding downstream 272271 46737435 ~ 46743033 (-)
LOC118964691 NA coding upstream 23852 47091238 ~ 47093901 (-)
LOC118964692 NA coding upstream 50468 47117854 ~ 47119664 (-)
LOC118964699 NA coding upstream 77036 47144422 ~ 47145496 (-)
LOC118964695 NA coding upstream 104028 47171414 ~ 47172690 (-)
LOC118964696 NA coding upstream 139117 47206503 ~ 47207921 (-)
G51181 NA non-coding downstream 32931 46977457 ~ 46982373 (-)
G51175 NA non-coding downstream 46159 46968445 ~ 46969145 (-)
G51165 NA non-coding downstream 47916 46924028 ~ 46967388 (-)
G51160 NA non-coding downstream 103345 46900164 ~ 46911959 (-)
G51137 NA non-coding upstream 7162 47074548 ~ 47123334 (-)
G51229 NA non-coding upstream 41749 47109135 ~ 47138083 (-)
G51236 NA non-coding upstream 61853 47129239 ~ 47163592 (-)
LOC110524061 LOC106573279 non-coding upstream 75138 47142524 ~ 47286344 (-)
G51246 NA non-coding upstream 122410 47189796 ~ 47219519 (-)
G49962 NA other downstream 1065353 45948958 ~ 45949951 (-)
G49774 NA other downstream 1294180 45720805 ~ 45721124 (-)
tspan9a LOC106573177 other downstream 3886275 42852829 ~ 43129052 (-)
G41868 NA other downstream 7993279 39021805 ~ 39022025 (-)
G40768 LOC106573348 other downstream 8823568 38187488 ~ 38191736 (-)
G51285 LOC106561952 other upstream 221553 47288939 ~ 47289681 (-)
G51649 LOC106573246 other upstream 310255 47377641 ~ 47378543 (-)
LOC110524104 LOC106573248 other upstream 474990 47541224 ~ 47561223 (-)
LOC110524264 LOC106573263 other upstream 1226722 48291626 ~ 48304829 (-)
LOC110532382 LOC106573120 other upstream 1916799 48971580 ~ 49044257 (-)

Expression


G51193 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 30.
End of interactive chart.

G51193 Expression in each Bioproject

Bar chart with 20 bars.
G51193 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 750.
End of interactive chart.

Co-expression Network