G52985 (LOC106573129)



Basic Information


Item Value
gene id G52985
gene name LOC106573129
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048565.1
NCBI id CM023219.2
chromosome length 95772356
location 48505510 ~ 48506091 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU59165
TGTGAAATCTGAAGCAGCTCCAGTACTGGGCCGAGCTGAACGGAACCTCCAGCCTGGAAGGGACAGTTACTAGGCAACGCTGGACCAGGTCTGATAACATCCGGAGCTCTCTGCCATTGGAGGGGCTCCCAGCTAGCTTACTGCTGGTAAAAAGGAGATAATCCATCCATAGCTTTTGAAGGACATTTAGCTGCATTACGGCTCCCAGGGCTCTCTCGAAAGCATCCTTCGCCTCCCCAACACTACCGTGCACCCA

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU59165 True 256 lncRNA 0.54 2 48505510 48506091

Neighbor


gene id symbol gene type direction distance location
LOC110524285 LOC106573130 coding downstream 41855 48440247 ~ 48463655 (-)
LOC110524273 LOC106573264 coding downstream 109129 48313665 ~ 48396381 (-)
LOC110524264 LOC106573263 coding downstream 200681 48291626 ~ 48304829 (-)
LOC110524242 NA coding downstream 258462 48219440 ~ 48247048 (-)
LOC110524212 LOC106573258 coding downstream 382154 48071829 ~ 48123356 (-)
nup160 nup160 coding upstream 92087 48598178 ~ 48623416 (-)
LOC110532369 LOC100136364 coding upstream 200891 48706982 ~ 48748537 (-)
LOC110524343 LOC106573121 coding upstream 308714 48814805 ~ 48892487 (-)
LOC110524359 capza2 coding upstream 395511 48901602 ~ 48958061 (-)
LOC110532382 LOC106573120 coding upstream 465489 48971580 ~ 49044257 (-)
G52973 LOC106573129 non-coding downstream 5883 48495624 ~ 48499627 (-)
G52948 NA non-coding downstream 37011 48448430 ~ 48468499 (-)
G52922 NA non-coding downstream 41470 48411508 ~ 48464040 (-)
G52881 NA non-coding downstream 147768 48357506 ~ 48357742 (-)
G52879 NA non-coding downstream 153625 48351570 ~ 48351885 (-)
G53008 LOC106573126 non-coding upstream 49728 48555819 ~ 48557902 (-)
G53524 NA non-coding upstream 606922 49113013 ~ 49113261 (-)
G53540 NA non-coding upstream 627850 49133941 ~ 49134182 (-)
G53541 NA non-coding upstream 628505 49134596 ~ 49135356 (-)
G53565 NA non-coding upstream 664081 49170172 ~ 49170575 (-)
LOC110524104 LOC106573248 other downstream 944301 47541224 ~ 47561223 (-)
G51649 LOC106573246 other downstream 1126967 47377641 ~ 47378543 (-)
G51285 LOC106561952 other downstream 1215829 47288939 ~ 47289681 (-)
G51214 NA other downstream 1386477 47064774 ~ 47236625 (-)
G55408 NA other upstream 1905543 50411634 ~ 50412128 (-)
G55627 NA other upstream 2259272 50765363 ~ 50767431 (-)
LOC110524514 borcs5 other upstream 2271656 50777716 ~ 50792069 (-)
G56372 NA other upstream 2894636 51400727 ~ 51412569 (-)

Expression


G52985(LOC106573129) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G52985(LOC106573129) Expression in each Bioproject

Bar chart with 10 bars.
G52985(LOC106573129) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 20.
End of interactive chart.

Co-expression Network