G53565



Basic Information


Item Value
gene id G53565
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048565.1
NCBI id CM023219.2
chromosome length 95772356
location 49170172 ~ 49170575 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU59788
tatatccttcctgtttggccctgggtatcatcggatggggccacagtgtctcctgacccctcctgtctcagcctccagtatttatgctgcagtagtttatgtgtcggggggctagggtcagtttgctatatctggagtacttctcctgtcttatccggtgtcctgtgtgaattcaagtatgctctctctaattctctctttctttctctctctcggaggacctgagccctaagaccatgcctcaggactacctggcatgatgactctttgctgtccccagtccacctggccgtgctgctgctccagtttcaactgttctgcctgcggctatggaatcctgacctgttcaccggacgtgctacctgtcccagacctgctgttttcaactctctagagacagcagg

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU59788 True 404 lncRNA 0.52 1 49170172 49170575
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110524381 cav2 coding downstream 65437 49098552 ~ 49104735 (-)
LOC110524368 LOC106573119 coding downstream 89458 49067489 ~ 49080714 (-)
LOC110532382 LOC106573120 coding downstream 125915 48971580 ~ 49044257 (-)
LOC110524359 capza2 coding downstream 212111 48901602 ~ 48958061 (-)
LOC110524343 LOC106573121 coding downstream 277685 48814805 ~ 48892487 (-)
LOC110524388 LOC106573117 coding upstream 9557 49180132 ~ 49208517 (-)
cbpa1 cbpa1 coding upstream 54137 49224712 ~ 49228631 (-)
LOC110532387 tmtc3 coding upstream 593420 49763995 ~ 49822972 (-)
LOC110524413 LOC106573141 coding upstream 677803 49848378 ~ 49876492 (-)
LOC110524441 LOC106573156 coding upstream 1089829 50260404 ~ 50270301 (-)
G53541 NA non-coding downstream 34816 49134596 ~ 49135356 (-)
G53540 NA non-coding downstream 35990 49133941 ~ 49134182 (-)
G53524 NA non-coding downstream 56911 49113013 ~ 49113261 (-)
G52974 NA non-coding downstream 568757 48497012 ~ 48601415 (-)
G53537 NA non-coding upstream 7274 49177849 ~ 49202748 (-)
G53651 NA non-coding upstream 108448 49279023 ~ 49279344 (-)
G53652 NA non-coding upstream 111085 49281660 ~ 49281864 (-)
G53655 NA non-coding upstream 112311 49282886 ~ 49283092 (-)
G53666 NA non-coding upstream 118624 49289199 ~ 49289470 (-)
LOC110524264 LOC106573263 other downstream 866036 48291626 ~ 48304829 (-)
LOC110524104 LOC106573248 other downstream 1608963 47541224 ~ 47561223 (-)
G51649 LOC106573246 other downstream 1791629 47377641 ~ 47378543 (-)
G51285 LOC106561952 other downstream 1880491 47288939 ~ 47289681 (-)
G55408 NA other upstream 1241059 50411634 ~ 50412128 (-)
G55627 NA other upstream 1594788 50765363 ~ 50767431 (-)
LOC110524514 borcs5 other upstream 1607172 50777716 ~ 50792069 (-)
G56372 NA other upstream 2230152 51400727 ~ 51412569 (-)
G56764 NA other upstream 2576042 51746617 ~ 51747220 (-)

Expression


G53565 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G53565 Expression in each Bioproject

Bar chart with 18 bars.
G53565 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network