G54902 (LOC100194703)



Basic Information


Item Value
gene id G54902
gene name LOC100194703
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048565.1
NCBI id CM023219.2
chromosome length 95772356
location 50424474 ~ 50425039 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU61171
tagttatcacttttgccttatggcaaggtgctccatcatgctggaaaaggcattgttcgtcaccaaactgttcctggatggttgggagaagttgctctcagaggatgtgttggtaccattctttattcatggctgtgttcttaggcaaaattgtgagtgagcccactcccttggctgagaagcaacctcacacatgaatggtctcaggatgctttactgttggcatgacacaggactgatggtagcgctcaccttgtcttctccggacaagcttttttccggatgccccaaacaatcggaaaggggattcatcagagaaaatgaatctaccccagtcctcagcagtccaatccctgtaccttttgcagaatatcagtctgtccctgatgtttttcctggagagaagtggcttccctgttgcccttcttgacaccaggccatcctccaaaagtcttcgcctcactgtgtgtgcagatgcactcacacctgcctgctgccatgcctgagcaagctctgtactggtggtgccccgatcccgcagctgaatcaactttagaagatggtcc

Function


NR:

description
transposase-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU61171 True 566 lncRNA 0.45 1 50424474 50425039
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110524434 LOC106573111 coding upstream 193409 50226356 ~ 50231065 (+)
LOC118964841 NA coding upstream 340934 50037523 ~ 50184257 (+)
LOC118964840 NA coding upstream 575495 49847620 ~ 49848979 (+)
LOC110524421 NA coding upstream 590471 49823910 ~ 49834003 (+)
kitlg scf coding upstream 721516 49666532 ~ 49702958 (+)
LOC110524453 LOC106573109 coding downstream 30517 50455556 ~ 50509791 (+)
LOC110524456 LOC106573106 coding downstream 105609 50530648 ~ 50592851 (+)
LOC110524482 LOC106573107 coding downstream 175596 50600635 ~ 50675495 (+)
LOC110524496 LOC106573105 coding downstream 367157 50792196 ~ 50800380 (+)
c1h11orf49 cssa16h11orf49 coding downstream 431541 50856580 ~ 50871347 (+)
G54901 NA non-coding upstream 219 50423931 ~ 50424255 (+)
G54900 NA non-coding upstream 558 50423620 ~ 50423916 (+)
G54889 NA non-coding upstream 24988 50399268 ~ 50399486 (+)
G54879 NA non-coding upstream 36169 50387874 ~ 50388305 (+)
G54878 NA non-coding upstream 37142 50387098 ~ 50387332 (+)
G54906 NA non-coding downstream 3539 50428578 ~ 50428905 (+)
G54907 NA non-coding downstream 4200 50429239 ~ 50429597 (+)
G55023 NA non-coding downstream 215521 50640560 ~ 50640778 (+)
G53181 NA other upstream 1530562 48893497 ~ 48893912 (+)
G52324 NA other upstream 2041217 48380542 ~ 48383257 (+)
G52080 NA other upstream 2399516 48006674 ~ 48024958 (+)
LOC110520864 NA other upstream 3165576 47227246 ~ 47260224 (+)
LOC110524575 fgf3 other downstream 1024783 51449353 ~ 51451460 (+)
LOC118936380 LOC106581842 other downstream 3241176 53632830 ~ 53705421 (+)
G59031 NA other downstream 3563101 53988140 ~ 53988597 (+)
LOC110525327 LOC106573036 other downstream 3619810 54044813 ~ 54089850 (+)
G59963 NA other downstream 4296149 54721188 ~ 54721463 (+)

Expression


G54902(LOC100194703) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G54902(LOC100194703) Expression in each Bioproject

Bar chart with 21 bars.
G54902(LOC100194703) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network