G58842



Basic Information


Item Value
gene id G58842
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048565.1
NCBI id CM023219.2
chromosome length 95772356
location 53588422 ~ 53588770 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU65415
agatgttatagttgggtatggaaatctctgaatttttggtggccttcctgagccaggattcagacacagcaaggacatcaggtttagcagagtgtgctaaagcagtgagtaaaacaaaattagggaggaggcttctgatgttgacatgcatgaaaccaaggctttttcgatcacagaagtcaacaaatgagggtgcctggggacatgcagggcctgggtttacctccacatcacccgcggaacagagaaggagtagtatgagggtgcggctaaaggctatcaaaactggtcgcctagagcgttggggacagagaataagaggagcaggtttctgggcatggtagaatat

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU65415 True 349 TUCP 0.48 1 53588422 53588770
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110525089 LOC106573055 coding downstream 203946 53373701 ~ 53384476 (-)
LOC110525078 LOC105021811 coding downstream 249938 53334724 ~ 53338484 (-)
LOC110525034 elk3 coding downstream 278297 53298363 ~ 53310125 (-)
ucmab LOC106573148 coding downstream 337519 53238335 ~ 53250903 (-)
LOC110524998 NA coding downstream 503699 53077658 ~ 53084723 (-)
LOC110525255 LOC106573039 coding upstream 124943 53713713 ~ 53758738 (-)
LOC110525178 LOC106581842 coding upstream 172842 53761612 ~ 53774544 (-)
LOC118964330 NA coding upstream 189771 53778541 ~ 53780182 (-)
LOC118964334 NA coding upstream 212259 53801029 ~ 53802670 (-)
LOC118964895 LOC106581842 coding upstream 225215 53813985 ~ 53822325 (-)
G58819 NA non-coding downstream 25212 53562953 ~ 53563210 (-)
G58751 NA non-coding downstream 26969 53465915 ~ 53561453 (-)
G58804 NA non-coding downstream 47202 53535776 ~ 53541220 (-)
G58778 NA non-coding downstream 69855 53499692 ~ 53518567 (-)
G58730 NA non-coding downstream 152405 53435761 ~ 53436017 (-)
G58846 NA non-coding upstream 2164 53590934 ~ 53591463 (-)
G58850 NA non-coding upstream 8353 53597123 ~ 53597796 (-)
G58926 NA non-coding upstream 43884 53632654 ~ 53634966 (-)
G58954 NA non-coding upstream 170922 53759692 ~ 53760058 (-)
G59104 NA non-coding upstream 241977 53830747 ~ 53835745 (-)
G58718 LOC100194703 other downstream 162106 53425964 ~ 53426316 (-)
G58565 LOC106561659 other downstream 448118 53139458 ~ 53140304 (-)
G57742 NA other downstream 1092188 52495898 ~ 52496234 (-)
G56764 NA other downstream 1841202 51746617 ~ 51747220 (-)
G58958 LOC106581842 other upstream 203060 53791830 ~ 53797014 (-)
G59978 NA other upstream 1140361 54729131 ~ 54737244 (-)
G60516 NA other upstream 1481622 55070392 ~ 55070899 (-)
G60572 NA other upstream 1561471 55150241 ~ 55154258 (-)

Expression


G58842 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G58842 Expression in each Bioproject

Bar chart with 18 bars.
G58842 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network