G59110



Basic Information


Item Value
gene id G59110
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048565.1
NCBI id CM023219.2
chromosome length 95772356
location 53856566 ~ 53917269 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU65712
cctagctacagtgccttgcgaaagtattcggcccccttgaactttgcgaccttttgccacatttcaggcttcaaacataaagatataaaaccgtatttttttgtgaagaatcaacaacaagtgggacacaatcatgaagtggaacgacatttattggatatttcaaacttttttaacaaatcaaaaaaggaaaaattgggcgtgcaaaattattcagcccccttaagttaatactttgtagcgccacc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU65712 True 248 lncRNA 0.38 2 53856566 53917269

Neighbor


gene id symbol gene type direction distance location
LOC118964340 NA coding downstream 14824 53840583 ~ 53841742 (-)
LOC118964896 LOC106581842 coding downstream 19978 53822057 ~ 53836588 (-)
LOC118964895 LOC106581842 coding downstream 34241 53813985 ~ 53822325 (-)
LOC118964334 NA coding downstream 53896 53801029 ~ 53802670 (-)
LOC118964330 NA coding downstream 76384 53778541 ~ 53780182 (-)
LOC110525320 snx33 coding upstream 72258 53989527 ~ 54019550 (-)
LOC110525336 pf21a coding upstream 195870 54113139 ~ 54223986 (-)
LOC110525355 LOC106573031 coding upstream 390781 54308050 ~ 54354027 (-)
LOC110525376 LOC106573030 coding upstream 455842 54373111 ~ 54382667 (-)
nat10 nat10 coding upstream 547138 54464407 ~ 54503021 (-)
G59104 NA non-coding downstream 20821 53830747 ~ 53835745 (-)
G58954 NA non-coding downstream 96508 53759692 ~ 53760058 (-)
G58926 NA non-coding downstream 221600 53632654 ~ 53634966 (-)
G58850 NA non-coding downstream 258770 53597123 ~ 53597796 (-)
G58846 NA non-coding downstream 265103 53590934 ~ 53591463 (-)
G59172 NA non-coding upstream 38046 53955315 ~ 53955541 (-)
G59178 NA non-coding upstream 54258 53971527 ~ 53971753 (-)
G59196 NA non-coding upstream 56936 53974205 ~ 53974501 (-)
G59197 LOC101154678 non-coding upstream 57374 53974643 ~ 53974863 (-)
G59198 NA non-coding upstream 57600 53974869 ~ 53975083 (-)
G58958 LOC106581842 other downstream 59552 53791830 ~ 53797014 (-)
LOC110525178 LOC106581842 other downstream 93670 53761612 ~ 53774544 (-)
G58842 NA other downstream 267796 53588422 ~ 53588770 (-)
G58718 LOC100194703 other downstream 430250 53425964 ~ 53426316 (-)
LOC110525078 LOC105021811 other downstream 518179 53334724 ~ 53338484 (-)
G59978 NA other upstream 811862 54729131 ~ 54737244 (-)
G60516 NA other upstream 1153123 55070392 ~ 55070899 (-)
G60572 NA other upstream 1232972 55150241 ~ 55154258 (-)
G60614 NA other upstream 1276028 55193297 ~ 55193723 (-)
G60624 NA other upstream 1286148 55203417 ~ 55203742 (-)

Expression


G59110 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G59110 Expression in each Bioproject

Bar chart with 15 bars.
G59110 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network