G59720



Basic Information


Item Value
gene id G59720
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048565.1
NCBI id CM023219.2
chromosome length 95772356
location 54255010 ~ 54259913 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU66360
gacgacagtctggttcaggcatgaatgacacaaacaaacaagaatccgacaaggacaggagcagaaacagagagagatatagggacctaatcagagggacaaaagggaacaggtggggaacggggtgaatgggtagttagaggagacaagggacagctgggggaaagcgggggagaaaaggtaacctaacacgaccagcagagggagacagggtgaagggaaaggacagagacaagacaacatgacagg

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU66360 True 249 lncRNA 0.50 2 54255010 54259913
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110525336 pf21a coding downstream 31024 54113139 ~ 54223986 (-)
LOC110525320 snx33 coding downstream 235460 53989527 ~ 54019550 (-)
LOC118964352 NA coding downstream 380774 53872120 ~ 53874236 (-)
LOC110525263 LOC106581842 coding downstream 386920 53853860 ~ 53868090 (-)
LOC118964340 NA coding downstream 413268 53840583 ~ 53841742 (-)
LOC110525355 LOC106573031 coding upstream 48137 54308050 ~ 54354027 (-)
LOC110525376 LOC106573030 coding upstream 113198 54373111 ~ 54382667 (-)
nat10 nat10 coding upstream 204494 54464407 ~ 54503021 (-)
caprin1b LOC100195798 coding upstream 244783 54504696 ~ 54570298 (-)
tspan18b tspan18 coding upstream 333290 54593203 ~ 54716059 (-)
G59625 NA non-coding downstream 68942 54185486 ~ 54186068 (-)
G59672 NA non-coding downstream 73380 54181174 ~ 54181630 (-)
G59673 NA non-coding downstream 74436 54180086 ~ 54180574 (-)
G59664 NA non-coding downstream 86767 54167968 ~ 54168243 (-)
G59721 NA non-coding upstream 19319 54279232 ~ 54297288 (-)
G59794 NA non-coding upstream 134131 54394044 ~ 54458919 (-)
G59956 NA non-coding upstream 439169 54699082 ~ 54705581 (-)
G59957 NA non-coding upstream 444717 54704630 ~ 54711130 (-)
G59959 NA non-coding upstream 457554 54717467 ~ 54717739 (-)
G58958 LOC106581842 other downstream 457996 53791830 ~ 53797014 (-)
LOC110525178 LOC106581842 other downstream 492114 53761612 ~ 53774544 (-)
G58842 NA other downstream 666240 53588422 ~ 53588770 (-)
G58718 LOC100194703 other downstream 828694 53425964 ~ 53426316 (-)
LOC110525078 LOC105021811 other downstream 916623 53334724 ~ 53338484 (-)
G59978 NA other upstream 469218 54729131 ~ 54737244 (-)
G60516 NA other upstream 810479 55070392 ~ 55070899 (-)
G60572 NA other upstream 890328 55150241 ~ 55154258 (-)
G60614 NA other upstream 933384 55193297 ~ 55193723 (-)
G60624 NA other upstream 943504 55203417 ~ 55203742 (-)

Expression


G59720 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G59720 Expression in each Bioproject

Bar chart with 13 bars.
G59720 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 80.
End of interactive chart.

Co-expression Network