G59978



Basic Information


Item Value
gene id G59978
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048565.1
NCBI id CM023219.2
chromosome length 95772356
location 54729131 ~ 54737244 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU66641
aagagcacctcctcccagctgcccactgcactgaggctaggaaacactgtcaccactgataaatccaccataatttaaaatttcaataagcatttttctactgctggccatgctttccacctggctactcctacccctgtcaacagcactgcacccccaacagcaactcgcccaagccttccccatttttccttctcccaaatccattcagctgatgttctgaaagagctgcaaaatctggacccctacaaatcagccgggctagacaatctggaccctttctttctaaaattatctgccgaaattgttgccacccctattactagcctgttcaacctctctttcgtgtcgtctgagattcccaaagattggaaagcagctgcggtcatccccctcttcaaagggggggacactcttgacccaaactgctacagacctatatctatcctaccatgcctttctaaggtcttcgaaagccaagtcaacaaacagattaccgaccattttgaatctcaccataccttctctgctatgcaatctggtttcagagctggtcatgggtgcacctcagccacgctcaaggtcctaaatgatatcttaaccgccatcgataagaaacattactgtgcagccgtattcattgatctggccaaggctttcgactctgtcaatcaccacatcctcatcggcagactcaacagccttggtttctcaaatgattgcctcgcctggttcaccaactacttctctgatagagttcagtgtgtcaaatcggagggtctgttgtccgaacctctggcagtctctatgggggtgccacagggttcaattcttggaccgactctcttctctgtatacatcaatgaggtcgctcttgctgctggtgagtctctgatccacctctacgcagacgacaccattctgtatacttccggcccttttttggacactgtgttaacaaccctccaggcaagcttcaatgccatacaactctccttccgtggcctccaattg

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU66641 True 1014 TUCP 0.43 2 54729131 54737244

Neighbor


gene id symbol gene type direction distance location
tspan18b tspan18 coding downstream 13072 54593203 ~ 54716059 (-)
caprin1b LOC100195798 coding downstream 158833 54504696 ~ 54570298 (-)
nat10 nat10 coding downstream 226110 54464407 ~ 54503021 (-)
LOC110525376 LOC106573030 coding downstream 346464 54373111 ~ 54382667 (-)
LOC110525355 LOC106573031 coding downstream 375104 54308050 ~ 54354027 (-)
LOC110525455 LOC106573025 coding upstream 93582 54830826 ~ 54872325 (-)
LOC110525462 LOC106561729 coding upstream 168113 54905357 ~ 54934644 (-)
LOC110525471 NA coding upstream 226212 54963456 ~ 54966553 (-)
LOC118964914 NA coding upstream 241667 54978911 ~ 55034259 (-)
LOC110525476 LOC106573024 coding upstream 334335 55071579 ~ 55128270 (-)
G59966 NA non-coding downstream 7399 54721411 ~ 54721732 (-)
G59965 NA non-coding downstream 7772 54720778 ~ 54721359 (-)
G59959 NA non-coding downstream 11392 54717467 ~ 54717739 (-)
G59957 NA non-coding downstream 18001 54704630 ~ 54711130 (-)
G59956 NA non-coding downstream 23550 54699082 ~ 54705581 (-)
G60002 NA non-coding upstream 11118 54748362 ~ 54748677 (-)
G60003 NA non-coding upstream 11514 54748758 ~ 54749109 (-)
G60061 NA non-coding upstream 60567 54797811 ~ 54798014 (-)
G60071 NA non-coding upstream 67799 54805043 ~ 54805319 (-)
G60079 NA non-coding upstream 73868 54811112 ~ 54811529 (-)
G58958 LOC106581842 other downstream 932117 53791830 ~ 53797014 (-)
LOC110525178 LOC106581842 other downstream 966235 53761612 ~ 53774544 (-)
G58842 NA other downstream 1140361 53588422 ~ 53588770 (-)
G58718 LOC100194703 other downstream 1302815 53425964 ~ 53426316 (-)
LOC110525078 LOC105021811 other downstream 1390744 53334724 ~ 53338484 (-)
G60516 NA other upstream 333148 55070392 ~ 55070899 (-)
G60572 NA other upstream 412997 55150241 ~ 55154258 (-)
G60614 NA other upstream 456053 55193297 ~ 55193723 (-)
G60624 NA other upstream 466173 55203417 ~ 55203742 (-)
G61563 NA other upstream 1095581 55832825 ~ 55833928 (-)

Expression


G59978 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G59978 Expression in each Bioproject

Bar chart with 20 bars.
G59978 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network