G61284 (LOC106573044)



Basic Information


Item Value
gene id G61284
gene name LOC106573044
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048565.1
NCBI id CM023219.2
chromosome length 95772356
location 56019476 ~ 56030371 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU68019
CTGTGACGACAGCTGCTTGTCTGTGATTCATTTTGTGTCTCTTGCAAGTCCTCACCTGGCGTGATGGCCACGCCATTCTCGTTGACCACGGGAGGGCTGCAGTCCTCCTCCTCAGGCAGCTCCAGGCTGGCTCGCTGCTCCATGTTGCTAACCGACTGGTTCCTCTTCCTCTTACCCTGGGCGCTGGGCCAGGCTCCGGGCAGCAGCGCCTCACTCACATTCAAGGGAGGGGCCGCCGGACTGGGCTCGGCTGGGGGCTTGGGAGTACCGTACAAGTTCT

Function


NR:

description
membrane-associated guanylate kinase, WW and PDZ domain-containing protein 2-like isoform X2

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU68019 True 280 TUCP 0.62 2 56019476 56030371
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110525514 LOC106573043 coding upstream 189290 55815371 ~ 55830186 (+)
LOC110525494 LOC106573015 coding upstream 281059 55674086 ~ 55738417 (+)
LOC110532459 NA coding upstream 347632 55562420 ~ 55671844 (+)
LOC110532453 reln coding upstream 496252 55226539 ~ 55523230 (+)
adal adal coding upstream 1555030 54445455 ~ 54464446 (+)
LOC110525521 LOC106576899 coding downstream 521377 56551748 ~ 56596653 (+)
eif3s6ip LOC106576896 coding downstream 863881 56894252 ~ 56904226 (+)
vsir cssa18h10orf54 coding downstream 1005237 57035608 ~ 57062851 (+)
LOC110525562 LOC106576893 coding downstream 1591896 57622267 ~ 57765398 (+)
LOC118964920 NA coding downstream 1664127 57694498 ~ 57722025 (+)
G61262 NA non-coding upstream 20298 55995345 ~ 55999178 (+)
G61218 LOC106560732 non-coding upstream 85149 55932232 ~ 55934327 (+)
G61198 NA non-coding upstream 118134 55900996 ~ 55901342 (+)
G61196 NA non-coding upstream 120400 55898060 ~ 55899076 (+)
G61194 NA non-coding upstream 122593 55896276 ~ 55896883 (+)
G61380 NA non-coding downstream 117531 56147902 ~ 56148117 (+)
G61383 NA non-coding downstream 119189 56149560 ~ 56149847 (+)
G61384 NA non-coding downstream 119822 56150193 ~ 56150566 (+)
G61721 NA non-coding downstream 130314 56160685 ~ 56160921 (+)
G61731 NA non-coding downstream 135340 56165711 ~ 56166088 (+)
G61202 LOC106573044 other upstream 96100 55905508 ~ 55923376 (+)
G59963 NA other upstream 1298013 54721188 ~ 54721463 (+)
LOC110525327 LOC106573036 other upstream 1957222 54044813 ~ 54089850 (+)
G59031 NA other upstream 2030879 53988140 ~ 53988597 (+)
LOC118936380 LOC106581842 other upstream 2348203 53632830 ~ 53705421 (+)
G61804 NA other downstream 216213 56246584 ~ 56247770 (+)
G61806 NA other downstream 219517 56249888 ~ 56252015 (+)
G63958 NA other downstream 2136194 58166565 ~ 58168178 (+)
G63959 fgfr2 other downstream 2191151 58221522 ~ 58223130 (+)
G64292 NA other downstream 2556487 58586858 ~ 58587585 (+)

Expression


G61284(LOC106573044) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 0.4.
End of interactive chart.

G61284(LOC106573044) Expression in each Bioproject

Bar chart with 4 bars.
G61284(LOC106573044) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 3.
End of interactive chart.

Co-expression Network