G61715



Basic Information


Item Value
gene id G61715
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048565.1
NCBI id CM023219.2
chromosome length 95772356
location 56153430 ~ 56153918 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU68495
tatgctggtgcggttggccctgggttcctcctaatgcaagtcaatgctagacctcatgtggctggagtgtgtcagcagttcctgcaagaggaaggcattgatgctatggactggcccgcccgttccccagacctgaatccaattgagcacatctgggacatcaggtctcgctccatccaccaacgccacgttgcaccacagactgtccaggagttggcggatgctttagtccaggtctgggaggagatccctcaggagaccatccgccacctcatcaggagcatgcccaggcgttgtagggaggtcatacaggcacgtggacgccacacacactactgagccttattgtgacttgttttaaggacattacatcaaagttggatcagcctgtagtgtggctttccactttaattttgagtgtgactccaaatccagacctccatgggttgataaatttgatttccattgataatttgtgtgattttgttg

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU68495 True 489 TUCP 0.43 1 56153430 56153918
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110525190 LOC106573044 coding downstream 6026 55901897 ~ 56147404 (-)
LOC110525232 NA coding downstream 73647 56069205 ~ 56079783 (-)
LOC110525505 LOC106573040 coding downstream 352391 55744407 ~ 55801039 (-)
LOC110525476 LOC106573024 coding downstream 1025160 55071579 ~ 55128270 (-)
LOC118964914 NA coding downstream 1119171 54978911 ~ 55034259 (-)
LOC110521481 LOC106573508 coding upstream 381751 56535669 ~ 56544298 (-)
smoc2 smoc2 coding upstream 637703 56791621 ~ 56873384 (-)
cdh23 cdh23 coding upstream 750691 56904609 ~ 57560442 (-)
LOC110525582 fgfr2 coding upstream 2015572 58166565 ~ 58282805 (-)
LOC110532479 ate1 coding upstream 2199727 58353645 ~ 58535096 (-)
G61635 NA non-coding downstream 66362 56033203 ~ 56087068 (-)
G61531 NA non-coding downstream 255271 55897741 ~ 55898159 (-)
G61530 NA non-coding downstream 313094 55840143 ~ 55840336 (-)
G61529 NA non-coding downstream 313621 55838753 ~ 55839809 (-)
G61564 NA non-coding downstream 316879 55836296 ~ 55836551 (-)
G61722 NA non-coding upstream 7204 56161122 ~ 56161351 (-)
G61730 NA non-coding upstream 11391 56165309 ~ 56165704 (-)
G61732 NA non-coding upstream 11881 56165799 ~ 56166059 (-)
G61744 NA non-coding upstream 24271 56178189 ~ 56178408 (-)
G61751 NA non-coding upstream 30160 56184078 ~ 56184536 (-)
G61563 NA other downstream 320070 55832825 ~ 55833928 (-)
G60624 NA other downstream 949688 55203417 ~ 55203742 (-)
G60614 NA other downstream 959707 55193297 ~ 55193723 (-)
G60572 NA other downstream 999172 55150241 ~ 55154258 (-)
G60516 NA other downstream 1082531 55070392 ~ 55070899 (-)
G61978 NA other upstream 371052 56524970 ~ 56533975 (-)
G63093 NA other upstream 881749 57035667 ~ 57062848 (-)
G63328 NA other upstream 1243276 57397194 ~ 57398488 (-)
G65147 NA other upstream 2630824 58784742 ~ 58785617 (-)
LOC110525695 LOC106576879 other upstream 2990455 59144373 ~ 59199471 (-)

Expression


G61715 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G61715 Expression in each Bioproject

Bar chart with 20 bars.
G61715 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network