G64292



Basic Information


Item Value
gene id G64292
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048565.1
NCBI id CM023219.2
chromosome length 95772356
location 58586858 ~ 58587585 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU71238
cagcccctttactttcagtgcagcaaactctctccagaagttcagtgaggatctctgaatgatccaatgttgacctaaatgactaatgatgataaatacaatccacctgtgtgtaatcaagtctccgtataaatgcacctgcactgtgatagtcttagaggtccgttaaaagcgcagagagcatcatgaagaacaaggaacacaccaggcaggtccgagatactgttgtgaagaagtttaaagccagatttggatacaaaaagatttcccaagctttaaacatcccaaggagcactgtgcaagcgataatattgaaatggaaggagtatcagaccacagcaaatctaccaagacctggccgtccctctaaactttcagctcatacaaggagaagactgatcagagatgcagccaagaggcccatgatcactctggatgaactgcagagatctccagctgaggtgggagactctgtccataggacaacaatcagtcgtatattgcacaaatctggcctttatggaagagtggcaagaagaaagccatttcttaaagatatccataaaaagtgttgtttaaagtttgccacaagccacctgggagacacaccaaacatgtggaagaaggtgctctggtcagatgaaaccaaaatggaactttttggcaacaatgcaaaacgttatgtttggtgtaaaagcaacacagctgaacacaccatccccactgtc

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG:

id description

RNA


RNA id representative length rna type GC content exon number start site end site
TU71238 True 728 TUCP 0.44 1 58586858 58587585

Neighbor


gene id symbol gene type direction distance location
LOC110525578 NA coding upstream 623035 57961716 ~ 57963823 (+)
wdr11 wdr11 coding upstream 648870 57806134 ~ 57940604 (+)
LOC110525562 LOC106576893 coding upstream 821460 57622267 ~ 57765398 (+)
LOC118964920 NA coding upstream 864833 57694498 ~ 57722025 (+)
vsir cssa18h10orf54 coding upstream 1524007 57035608 ~ 57062851 (+)
fam160b1 fam160b1 coding downstream 220785 58808370 ~ 58838199 (+)
trnaa-ugc NA coding downstream 474222 59061807 ~ 59061880 (+)
LOC110525756 NA coding downstream 622421 59210006 ~ 59212175 (+)
erlin1 LOC106576878 coding downstream 696739 59284324 ~ 59299682 (+)
si:ch211-217g15.3 LOC106576876 coding downstream 752954 59340539 ~ 59342276 (+)
G64248 NA non-coding upstream 164 58585290 ~ 58586694 (+)
G64274 NA non-coding upstream 26388 58560233 ~ 58560470 (+)
G64273 NA non-coding upstream 27588 58559071 ~ 58559270 (+)
G64269 NA non-coding upstream 32288 58554212 ~ 58554570 (+)
G64250 NA non-coding upstream 32955 58553678 ~ 58553903 (+)
G64293 NA non-coding downstream 248 58587833 ~ 58588113 (+)
G64242 LOC106586415 non-coding downstream 3528 58591113 ~ 58661566 (+)
G64241 NA non-coding downstream 9123 58596708 ~ 58598513 (+)
G64312 NA non-coding downstream 74126 58661711 ~ 58661946 (+)
G64313 ablim1 non-coding downstream 74628 58662213 ~ 58662478 (+)
G63959 fgfr2 other upstream 363728 58221522 ~ 58223130 (+)
G63958 NA other upstream 418680 58166565 ~ 58168178 (+)
G61806 NA other upstream 2334843 56249888 ~ 56252015 (+)
G61804 NA other upstream 2339088 56246584 ~ 56247770 (+)
G61284 LOC106573044 other upstream 2556487 56019476 ~ 56030371 (+)
G64315 NA other downstream 77749 58665334 ~ 58665906 (+)
G64338 NA other downstream 111711 58699296 ~ 58700379 (+)
G65442 NA other downstream 737051 59324636 ~ 59325129 (+)
G66188 NA other downstream 1353901 59941486 ~ 59942064 (+)
G67806 LOC106581772 other downstream 2727289 61314874 ~ 61315252 (+)

Expression


G64292 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G64292 Expression in each Bioproject

Bar chart with 20 bars.
G64292 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network