G64346



Basic Information


Item Value
gene id G64346
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048565.1
NCBI id CM023219.2
chromosome length 95772356
location 58713247 ~ 58713516 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU71292
tttcaatctttttattaacaaatcaaaaactgaaaaattgggcgtgcaaaattattcagcccctttactgtctctatcagttttgcacatcgagagactgcaattttttcccattcctccttacaaaacagctcgagctcagtgaggttggatggagagcatttgtgaacagcacttttcagttctttccacagattctcgattggattcaggtctggactttgacttggccattctaacacctggatatgtttatttttgaaccattcc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU71292 True 270 lncRNA 0.42 1 58713247 58713516

Neighbor


gene id symbol gene type direction distance location
LOC110525578 NA coding upstream 749424 57961716 ~ 57963823 (+)
wdr11 wdr11 coding upstream 775259 57806134 ~ 57940604 (+)
LOC110525562 LOC106576893 coding upstream 947849 57622267 ~ 57765398 (+)
LOC118964920 NA coding upstream 991222 57694498 ~ 57722025 (+)
vsir cssa18h10orf54 coding upstream 1650396 57035608 ~ 57062851 (+)
fam160b1 fam160b1 coding downstream 94854 58808370 ~ 58838199 (+)
trnaa-ugc NA coding downstream 348291 59061807 ~ 59061880 (+)
LOC110525756 NA coding downstream 496490 59210006 ~ 59212175 (+)
erlin1 LOC106576878 coding downstream 570808 59284324 ~ 59299682 (+)
si:ch211-217g15.3 LOC106576876 coding downstream 627023 59340539 ~ 59342276 (+)
G64345 NA non-coding upstream 1299 58711732 ~ 58711948 (+)
G64342 NA non-coding upstream 8859 58704178 ~ 58704388 (+)
G64341 NA non-coding upstream 10849 58702155 ~ 58702398 (+)
G64339 NA non-coding upstream 12442 58700456 ~ 58700805 (+)
G64336 NA non-coding upstream 16147 58696700 ~ 58697100 (+)
G64347 NA non-coding downstream 813 58714329 ~ 58771034 (+)
G64394 NA non-coding downstream 126622 58840138 ~ 58840812 (+)
G64397 NA non-coding downstream 127643 58841159 ~ 58843049 (+)
G64440 NA non-coding downstream 145312 58858828 ~ 58862006 (+)
G64577 NA non-coding downstream 334028 59047544 ~ 59048259 (+)
G64338 NA other upstream 12868 58699296 ~ 58700379 (+)
G64315 NA other upstream 47341 58665334 ~ 58665906 (+)
G64292 NA other upstream 125662 58586858 ~ 58587585 (+)
G63959 fgfr2 other upstream 490117 58221522 ~ 58223130 (+)
G63958 NA other upstream 545069 58166565 ~ 58168178 (+)
G65442 NA other downstream 611120 59324636 ~ 59325129 (+)
G66188 NA other downstream 1227970 59941486 ~ 59942064 (+)
G67806 LOC106581772 other downstream 2601358 61314874 ~ 61315252 (+)
G67930 mcmbp other downstream 3016249 61729765 ~ 61733388 (+)
G70011 NA other downstream 4561447 63274963 ~ 63275296 (+)

Expression


G64346 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G64346 Expression in each Bioproject

Bar chart with 13 bars.
G64346 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 25.
End of interactive chart.

Co-expression Network