G65442



Basic Information


Item Value
gene id G65442
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048565.1
NCBI id CM023219.2
chromosome length 95772356
location 59324636 ~ 59325129 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU72488
gccctagacccactccaatttgcttaccgcccaaataggtccacagacgatgcaatctcaaccacactgcacactgccctaacccatctggacaagaggaatacctatgtgagaatgctgttcatcgactacagctcggcattcaacaccatagtaccctccaagctcgtcatcaagctcgagaccctgggtctcgaccccgccctgtgcaactgggtactggacttcctgacgggccgcccccaggtggtgagggtaggcaacaacatctcctccccgctgatcctcaacactggggccccacaagggtgcgttctgagccctctcctgtactccctgttcacccacgactgcgtggccacgcacgcctccaactcaatcatcaagtttgcggacgacacaacagtggtaggcttgattaccaacaacgatgagacggcctacagggaggaggtgagggccctcggagtgtggtgtcaggaaaataacctcac

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU72488 True 494 TUCP 0.57 1 59324636 59325129

Neighbor


gene id symbol gene type direction distance location
erlin1 LOC106576878 coding upstream 24954 59284324 ~ 59299682 (+)
LOC110525756 NA coding upstream 112461 59210006 ~ 59212175 (+)
trnaa-ugc NA coding upstream 262756 59061807 ~ 59061880 (+)
fam160b1 fam160b1 coding upstream 486437 58808370 ~ 58838199 (+)
LOC110525578 NA coding upstream 1360813 57961716 ~ 57963823 (+)
si:ch211-217g15.3 LOC106576876 coding downstream 15410 59340539 ~ 59342276 (+)
cxcf1a cxcf1a coding downstream 158352 59483481 ~ 59485882 (+)
cxcl12a cxcl12a coding downstream 264535 59589595 ~ 59631391 (+)
LOC110525860 NA coding downstream 274776 59599905 ~ 59608419 (+)
ercc6 ercc6 coding downstream 400489 59725618 ~ 59778737 (+)
G65441 NA non-coding upstream 3621 59320804 ~ 59321015 (+)
G65432 NA non-coding upstream 19653 59304766 ~ 59304983 (+)
G64718 NA non-coding upstream 44323 59275245 ~ 59280313 (+)
G64716 NA non-coding upstream 52145 59272211 ~ 59272491 (+)
G64645 LOC100196663 non-coding upstream 90071 59212441 ~ 59234565 (+)
G65446 NA non-coding downstream 2527 59327656 ~ 59327869 (+)
G65448 NA non-coding downstream 5972 59331101 ~ 59331325 (+)
G65456 NA non-coding downstream 23226 59348355 ~ 59348657 (+)
G65458 echs1 non-coding downstream 29991 59355120 ~ 59368018 (+)
G65488 NA non-coding downstream 66023 59391152 ~ 59392490 (+)
G64338 NA other upstream 624257 58699296 ~ 58700379 (+)
G64315 NA other upstream 658730 58665334 ~ 58665906 (+)
G64292 NA other upstream 737051 58586858 ~ 58587585 (+)
G63959 fgfr2 other upstream 1101506 58221522 ~ 58223130 (+)
G63958 NA other upstream 1156458 58166565 ~ 58168178 (+)
G66188 NA other downstream 616357 59941486 ~ 59942064 (+)
G67806 LOC106581772 other downstream 1989745 61314874 ~ 61315252 (+)
G67930 mcmbp other downstream 2404636 61729765 ~ 61733388 (+)
G70011 NA other downstream 3949834 63274963 ~ 63275296 (+)
LOC110526969 stk32c other downstream 5484460 64809255 ~ 64946164 (+)

Expression


G65442 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 75.
End of interactive chart.

G65442 Expression in each Bioproject

Bar chart with 15 bars.
G65442 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 800.
End of interactive chart.

Co-expression Network