G66155



Basic Information


Item Value
gene id G66155
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048565.1
NCBI id CM023219.2
chromosome length 95772356
location 59912344 ~ 59913305 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU73288
accctccagaaaacgagcgagcaaagccggctcgttccagccactggaggcagcaagagtgcgaaactcaatagagtagtctgttatggatcgattaccttgacatagggaagacaggaccctggaagcctcctccccaaaaacagatcgatcaaaaacccgtatcatctcctccttaaagtcctgatactggttagtacactcagcccttgcctcccagattgccgtgccccactcacgagcccgtccaataaggagagatatgacgtaggcgacacgagcagtgctcctggagaaagtgttgggctggagagaaaacacaatatcacactgggtgaggaacgagcggcattcagtgggctccccagagtaacacggcgggttattgattctgggctccggagatttgaaagccctggaagtggccggtggatcgaggcggagatggtgaacctgttctgtgaggttggagacttgggtggccagggtctcaacggcatgtcgagcagcagacaattcctgctcgtgtctgcctagcatcgctccctggatcccgacggctgagtggagaggatccgaagtcgctgggtccattcttggtcggattcttctgttacggtgcgtgaatgaggacccaaaagcgaattaacttaaacagagcttctttaattaccaaacataggtaggctcagatggaccggcagattccgacaggacaggacaaggttacagcaaacatgacgacagtctggttcaggcatgaaacacaacaaacaagaatccgacaaagacaggagcagaaacagagagagatatagggacctaatcagagggaaaaagggaacaggtgggaaaaggggtgacgaggtagttaggaggagacaaggcacagctgggggaaagagggggagaaaaggtaacctaacaacgaccagcagagggagacagggtgaagggaaagg

Function


NR:

description
PREDICTED: protein LDOC1-like, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU73288 True 962 lncRNA 0.52 1 59912344 59913305
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110532486 LOC106595224 coding downstream 268059 59549868 ~ 59644285 (-)
tmem72 tmem72 coding downstream 395612 59511553 ~ 59516732 (-)
rassf4a rassf4 coding downstream 405276 59438585 ~ 59507068 (-)
si:dkey-275b16.2 paox coding downstream 489927 59406144 ~ 59422417 (-)
mtg1 mtg1 coding downstream 513664 59379812 ~ 59398680 (-)
LOC118964951 NA coding upstream 103691 60016544 ~ 60024584 (-)
LOC110525944 LOC106576863 coding upstream 113913 60027218 ~ 60064906 (-)
LOC110525964 LOC106576862 coding upstream 176685 60089990 ~ 60124142 (-)
LOC110525977 LOC106576859 coding upstream 217010 60130315 ~ 60172542 (-)
LOC110526047 LOC106576854 coding upstream 368367 60281672 ~ 60301313 (-)
G66154 NA non-coding downstream 278 59911207 ~ 59912066 (-)
G66147 NA non-coding downstream 3987 59908145 ~ 59908357 (-)
G66146 NA non-coding downstream 4335 59907724 ~ 59908009 (-)
G66120 NA non-coding downstream 21256 59890408 ~ 59891088 (-)
G66108 NA non-coding downstream 30308 59881452 ~ 59882036 (-)
G66764 NA non-coding upstream 28192 59941497 ~ 59942056 (-)
G66767 NA non-coding upstream 32614 59945919 ~ 59946179 (-)
G66769 NA non-coding upstream 33744 59947049 ~ 59947340 (-)
G66773 NA non-coding upstream 37344 59950649 ~ 59950873 (-)
G66782 NA non-coding upstream 48752 59962057 ~ 59962302 (-)
LOC110525695 LOC106576879 other downstream 757199 59144373 ~ 59199471 (-)
G65147 NA other downstream 1126727 58784742 ~ 58785617 (-)
G63328 NA other downstream 2513856 57397194 ~ 57398488 (-)
G63093 NA other downstream 2849496 57035667 ~ 57062848 (-)
G61978 NA other downstream 3378369 56524970 ~ 56533975 (-)
LOC110526097 LOC106576849 other upstream 516902 60430184 ~ 60495300 (-)
G68736 NA other upstream 1768973 61682278 ~ 61686308 (-)
LOC110526417 LOC106576819 other upstream 2068426 61981652 ~ 61983330 (-)
G69210 NA other upstream 2498217 62411522 ~ 62418296 (-)
G70013 NA other upstream 3363903 63277208 ~ 63277752 (-)

Expression


G66155 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G66155 Expression in each Bioproject

Bar chart with 20 bars.
G66155 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network