G66188


Basic Information

Item Value
gene id G66188
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048565.1
NCBI id CM023219.2
chromosome length 95772356
location 59941486 ~ 59942064 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU73321
tgcaacattattcagcccctttactttcagtgcagcaaactctctccagaagttcagtgaggatctatgaatgatccaatgttgacctaaatgactaatgatgataaatacaatccacctgtgtgtaaccaagtctccgtataaatgcacctgcactgtgatagtctcagaggtccgttaaaagcgcagagagcatcatgaagaacaaggaacacaccaggcaggtccgagatactgttttgaagaagtttaaagccggatttggatacaaaaagatttcccaagctttaaacatcccaaggagcactgtgcaagcgataatattgaaatggaaggaatatcagaccactgcaaatctaccaagacctggccgtccctctaaactttcagctcatacaaggagaagactgatcagagatgcagccaagaggcccatgatcactctggatgaactgcagagatctacagctgaggtgggagactctgtccataggacaacaatcagtcgtatattgcacaaatctggcctttatggaagagtggcaagaagaaagccatttcttaaagatatccataaaa

Function

NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU73321 True 579 TUCP 0.42 1 59941486 59942064
Loading

Neighbor

gene id symbol gene type direction distance location
lrrc18a LOC106576925 coding upstream 14348 59922675 ~ 59927138 (+)
drgx LOC106576867 coding upstream 147723 59786129 ~ 59793763 (+)
ercc6 ercc6 coding upstream 162749 59725618 ~ 59778737 (+)
cxcl12a cxcl12a coding upstream 313232 59589595 ~ 59631391 (+)
LOC110525860 NA coding upstream 333067 59599905 ~ 59608419 (+)
si:ch211-223a10.1 LOC106576865 coding downstream 27448 59969512 ~ 59993651 (+)
LOC110525930 LOC106576864 coding downstream 57346 59999410 ~ 60018695 (+)
LOC110526033 LOC106576855 coding downstream 241151 60183215 ~ 60218672 (+)
LOC118966766 NA coding downstream 275057 60217121 ~ 60217262 (+)
LOC110526041 LOC106576856 coding downstream 287407 60229471 ~ 60264209 (+)
G66187 NA non-coding upstream 2674 59938558 ~ 59938812 (+)
G66145 NA non-coding upstream 33497 59907712 ~ 59907989 (+)
G66142 NA non-coding upstream 33785 59907120 ~ 59907701 (+)
G66121 NA non-coding upstream 49620 59891511 ~ 59891866 (+)
G66214 NA non-coding downstream 78413 60020477 ~ 60020701 (+)
G66225 NA non-coding downstream 85173 60027237 ~ 60091030 (+)
G66269 LOC106576859 non-coding downstream 188255 60130319 ~ 60141209 (+)
G66308 NA non-coding downstream 233914 60175978 ~ 60176307 (+)
G66310 NA non-coding downstream 237832 60179896 ~ 60180249 (+)
G65442 NA other upstream 616357 59324636 ~ 59325129 (+)
G64338 NA other upstream 1241107 58699296 ~ 58700379 (+)
G64315 NA other upstream 1275580 58665334 ~ 58665906 (+)
G64292 NA other upstream 1353901 58586858 ~ 58587585 (+)
G63959 fgfr2 other upstream 1718356 58221522 ~ 58223130 (+)
G67806 LOC106581772 other downstream 1372810 61314874 ~ 61315252 (+)
G67930 mcmbp other downstream 1787701 61729765 ~ 61733388 (+)
G70011 NA other downstream 3332899 63274963 ~ 63275296 (+)
LOC110526969 stk32c other downstream 4867525 64809255 ~ 64946164 (+)
LOC110527164 LOC106576754 other downstream 5973671 65915581 ~ 65922285 (+)

Expression

G66188 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G66188 Expression in each Bioproject

Bar chart with 20 bars.
G66188 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network