G67993 (ret)


Basic Information

Item Value
gene id G67993
gene name ret
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048565.1
NCBI id CM023219.2
chromosome length 95772356
location 61761463 ~ 61762278 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU75259
CCAGTCTTGAGGAGGTTAAAGAGGCGTTCAGGGGCGATGCCTGGGTACGGGTTTCCACCCAGTGTCACAATCTCCCACAACAGCACACCAAAGGACCAGACGTCACTTTGTGTTGTGTAAATGTGATCAAACAAGGATTCTATTGCCATCCATTTCACTGGGATTCGACCCTTGCTCCTCTTCACATATGAGTCTTCCTCATACACGTCCCGGGACAAACCAAAGTCTGAAATCTTC

Function

symbol description
ret Enables protein homodimerization activity. Acts upstream of or within several processes, including autonomic nervous system development; axon extension; and branchiomeric skeletal muscle development. Predicted to be located in membrane raft and plasma membrane. Predicted to be part of receptor complex. Predicted to be active in axon. Predicted to be integral component of plasma membrane. Is expressed in nervous system; pharyngeal arch; presumptive enteric nervous system; pronephric duct; and vagal neural crest. Used to study Hirschsprung's disease. Human ortholog(s) of this gene implicated in several diseases, including Hirschsprung's disease; congenital central hypoventilation syndrome; familial medullary thyroid carcinoma; multiple endocrine neoplasia type 2A; and multiple endocrine neoplasia type 2B. Orthologous to human RET (ret proto-oncogene).

NR:

description
PREDICTED: proto-oncogene tyrosine-protein kinase receptor Ret-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU75259 True 237 lncRNA 0.64 3 61761463 61762278

Neighbor

gene id symbol gene type direction distance location
sec23ip LOC106576824 coding upstream 16306 61733628 ~ 61745157 (+)
inpp5f LOC106576825 coding upstream 51394 61687566 ~ 61710069 (+)
bag3 bag3 coding upstream 77295 61677780 ~ 61684168 (+)
pkd2l1 pkd2l1 coding upstream 115282 61635163 ~ 61646181 (+)
atoh7 atoh7 coding upstream 129936 61629925 ~ 61631527 (+)
fam204a LOC106576816 coding downstream 301972 62064250 ~ 62097505 (+)
LOC110526440 LOC106576815 coding downstream 391071 62153349 ~ 62168687 (+)
LOC110526492 LOC106576813 coding downstream 598711 62360989 ~ 62366199 (+)
LOC110526511 LOC100194723 coding downstream 621412 62383690 ~ 62390008 (+)
LOC110526533 LOC106576809 coding downstream 673004 62435282 ~ 62492911 (+)
G67982 NA non-coding upstream 80855 61680139 ~ 61680608 (+)
G67968 NA non-coding upstream 114791 61646440 ~ 61646672 (+)
G67955 NA non-coding upstream 134332 61626927 ~ 61627131 (+)
G67905 NA non-coding upstream 135317 61624717 ~ 61626146 (+)
G68018 NA non-coding downstream 30310 61792588 ~ 61792802 (+)
G68019 NA non-coding downstream 30771 61793049 ~ 61793884 (+)
G68046 NA non-coding downstream 69747 61832025 ~ 61948733 (+)
G68105 pdli1 non-coding downstream 139997 61902275 ~ 61916554 (+)
G68075 NA non-coding downstream 158796 61921074 ~ 61926149 (+)
G67930 mcmbp other upstream 28075 61729765 ~ 61733388 (+)
G67806 LOC106581772 other upstream 446211 61314874 ~ 61315252 (+)
G66188 NA other upstream 1819399 59941486 ~ 59942064 (+)
G65442 NA other upstream 2436334 59324636 ~ 59325129 (+)
G64338 NA other upstream 3061084 58699296 ~ 58700379 (+)
G70011 NA other downstream 1512685 63274963 ~ 63275296 (+)
LOC110526969 stk32c other downstream 3047311 64809255 ~ 64946164 (+)
LOC110527164 LOC106576754 other downstream 4153457 65915581 ~ 65922285 (+)
G73515 NA other downstream 4525401 66287679 ~ 66288469 (+)
LOC118965274 LOC106576739 other downstream 4658217 66417495 ~ 66424081 (+)

Expression


Co-expression Network