G68018



Basic Information


Item Value
gene id G68018
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048565.1
NCBI id CM023219.2
chromosome length 95772356
location 61792588 ~ 61792802 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU75284
ggaaaataagtattttgtcaacaacaaaagtttatctcaatactttgttatataccctttgttggcaatgacagaggtcaaacgttttctgtaagtcttcacaatgttttcacacactgttgctggtattttggcccattcctccatgcagatctcctctagatcagtgatgttttggggctgttgctgggcaacacagactttcaactccctcc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU75284 True 215 lncRNA 0.58 1 61792588 61792802

Neighbor


gene id symbol gene type direction distance location
sec23ip LOC106576824 coding upstream 47431 61733628 ~ 61745157 (+)
inpp5f LOC106576825 coding upstream 82519 61687566 ~ 61710069 (+)
bag3 bag3 coding upstream 108420 61677780 ~ 61684168 (+)
pkd2l1 pkd2l1 coding upstream 146407 61635163 ~ 61646181 (+)
atoh7 atoh7 coding upstream 161061 61629925 ~ 61631527 (+)
fam204a LOC106576816 coding downstream 271448 62064250 ~ 62097505 (+)
LOC110526440 LOC106576815 coding downstream 360547 62153349 ~ 62168687 (+)
LOC110526492 LOC106576813 coding downstream 568187 62360989 ~ 62366199 (+)
LOC110526511 LOC100194723 coding downstream 590888 62383690 ~ 62390008 (+)
LOC110526533 LOC106576809 coding downstream 642480 62435282 ~ 62492911 (+)
G67993 ret non-coding upstream 30310 61761463 ~ 61762278 (+)
G67982 NA non-coding upstream 111980 61680139 ~ 61680608 (+)
G67968 NA non-coding upstream 145916 61646440 ~ 61646672 (+)
G67955 NA non-coding upstream 165457 61626927 ~ 61627131 (+)
G68019 NA non-coding downstream 247 61793049 ~ 61793884 (+)
G68046 NA non-coding downstream 39223 61832025 ~ 61948733 (+)
G68105 pdli1 non-coding downstream 109473 61902275 ~ 61916554 (+)
G68075 NA non-coding downstream 128272 61921074 ~ 61926149 (+)
G68076 LOC106576818 non-coding downstream 144718 61937520 ~ 61939608 (+)
G67930 mcmbp other upstream 59200 61729765 ~ 61733388 (+)
G67806 LOC106581772 other upstream 477336 61314874 ~ 61315252 (+)
G66188 NA other upstream 1850524 59941486 ~ 59942064 (+)
G65442 NA other upstream 2467459 59324636 ~ 59325129 (+)
G64338 NA other upstream 3092209 58699296 ~ 58700379 (+)
G70011 NA other downstream 1482161 63274963 ~ 63275296 (+)
LOC110526969 stk32c other downstream 3016787 64809255 ~ 64946164 (+)
LOC110527164 LOC106576754 other downstream 4122933 65915581 ~ 65922285 (+)
G73515 NA other downstream 4494877 66287679 ~ 66288469 (+)
LOC118965274 LOC106576739 other downstream 4627693 66417495 ~ 66424081 (+)

Expression


G68018 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G68018 Expression in each Bioproject

Bar chart with 19 bars.
G68018 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network