G68119


Basic Information

Item Value
gene id G68119
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048565.1
NCBI id CM023219.2
chromosome length 95772356
location 61964814 ~ 61965178 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU75390
CCTGGGCTTGAGTTCTGTTGACTGTAGGTAAATCAGCTGTGATGTCGTGGAAGCATCCATCAGCAAATCCCGTTTGAGCGCTGTCTCCATTGATCTGGCCGATCCAACCACCTGAAATGATCCAAAAACAATCTCAGTTTGGCCAGTGAATAACAGTGCAAGACGACCAGAATCCGAACAATACTGAAAGATACACAAACAAACCACTGTACTCTTGGCAATCTTTGTCTCTTGGCAATTAACACGTTTCAGAGATTAACACCAAACTACAAACAGGAAACAATTCATCCTCAATTAAATACATCTCTGGCTGATCCTGCGGTGACCAAACGCTTCCTATAGCGCTTTTCCCGGACAGAGATGCT

Function

NR:

description
sorbin and SH3 domain-containing protein 1-like isoform X5

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU75390 True 365 lncRNA 0.44 1 61964814 61965178

Neighbor

gene id symbol gene type direction distance location
sec23ip LOC106576824 coding upstream 219657 61733628 ~ 61745157 (+)
inpp5f LOC106576825 coding upstream 254745 61687566 ~ 61710069 (+)
bag3 bag3 coding upstream 280646 61677780 ~ 61684168 (+)
pkd2l1 pkd2l1 coding upstream 318633 61635163 ~ 61646181 (+)
atoh7 atoh7 coding upstream 333287 61629925 ~ 61631527 (+)
fam204a LOC106576816 coding downstream 99072 62064250 ~ 62097505 (+)
LOC110526440 LOC106576815 coding downstream 188171 62153349 ~ 62168687 (+)
LOC110526492 LOC106576813 coding downstream 395811 62360989 ~ 62366199 (+)
LOC110526511 LOC100194723 coding downstream 418512 62383690 ~ 62390008 (+)
LOC110526533 LOC106576809 coding downstream 470104 62435282 ~ 62492911 (+)
G68118 NA non-coding upstream 62 61964237 ~ 61964752 (+)
G68117 NA non-coding upstream 1342 61963176 ~ 61963472 (+)
G68116 NA non-coding upstream 3586 61961027 ~ 61961228 (+)
G68114 NA non-coding upstream 5737 61958813 ~ 61959077 (+)
G68112 NA non-coding upstream 9034 61954113 ~ 61955780 (+)
G68127 NA non-coding downstream 10703 61975881 ~ 61976097 (+)
G68130 NA non-coding downstream 12671 61977849 ~ 61978063 (+)
G68132 LOC106576819 non-coding downstream 16555 61981733 ~ 61982921 (+)
G68384 NA non-coding downstream 449502 62414680 ~ 62416124 (+)
G68469 NA non-coding downstream 566991 62532169 ~ 62532538 (+)
G67930 mcmbp other upstream 231426 61729765 ~ 61733388 (+)
G67806 LOC106581772 other upstream 649562 61314874 ~ 61315252 (+)
G66188 NA other upstream 2022750 59941486 ~ 59942064 (+)
G65442 NA other upstream 2639685 59324636 ~ 59325129 (+)
G64338 NA other upstream 3264435 58699296 ~ 58700379 (+)
G70011 NA other downstream 1309785 63274963 ~ 63275296 (+)
LOC110526969 stk32c other downstream 2844411 64809255 ~ 64946164 (+)
LOC110527164 LOC106576754 other downstream 3950557 65915581 ~ 65922285 (+)
G73515 NA other downstream 4322501 66287679 ~ 66288469 (+)
LOC118965274 LOC106576739 other downstream 4455317 66417495 ~ 66424081 (+)

Expression


Co-expression Network