G69980



Basic Information


Item Value
gene id G69980
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048565.1
NCBI id CM023219.2
chromosome length 95772356
location 63228093 ~ 63228547 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU77473
AAATAATACAAATGATGCTTACTTATGCAGCTGTAATTTCACAGTGGTGTTCACATAGCCGTTCTTGGCCCTGAGGGTTTTGATGCGCTTCCAAGCAGCAACAATGTTCCTCACCAGAGAGATGTCTGCCTGCTTCTCAATCTTCAGTGCTACATGGGTCTTTCTGCAGTGAGCGGATTCATTCAAGCAATACCTTTACAAACATAGAGGTACAGTAAAGAATCGTATTTCTTAGAACAGAAATCCCTCTCACCGTATTTCCTGTCTCAGATCCTGTAACTTTGAGCAAGGAGCAGTTTCATCAGTGGTGGTCAAGGCTGTTTCTGACTTCTTCAGCCCGCTTAGCTACCAGGGGTGAGGTACAAAAAAATATTTCAGATTAACAATATACTATGGTATGACTGCATTCCTTTCCCCAAATGATTTCAATTGTACGTTTTGTGATAGTGTTGTAC

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU77473 True 455 lncRNA 0.56 1 63228093 63228547
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110526655 LOC106576794 coding downstream 4409 63148644 ~ 63223684 (-)
march5b march5b coding downstream 152753 63031594 ~ 63075340 (-)
LOC110532536 LOC106576798 coding downstream 253229 62954227 ~ 62974864 (-)
LOC110526605 LOC106576802 coding downstream 405025 62751363 ~ 62823068 (-)
LOC110526600 NA coding downstream 560965 62665097 ~ 62667128 (-)
ccnj ccnj coding upstream 16903 63245450 ~ 63266545 (-)
blnk LOC106576789 coding upstream 64813 63293360 ~ 63325494 (-)
vent LOC106576918 coding upstream 396287 63624834 ~ 63625877 (-)
vox LOC106576785 coding upstream 399688 63628235 ~ 63630418 (-)
LOC110532553 LOC106576784 coding upstream 402023 63630570 ~ 63654636 (-)
G69903 LOC106576796 non-coding downstream 148396 63078898 ~ 63079697 (-)
G69854 NA non-coding downstream 197472 63028262 ~ 63030621 (-)
G69864 NA non-coding downstream 244367 62983464 ~ 62983726 (-)
G69689 NA non-coding downstream 246194 62981658 ~ 62981899 (-)
G69661 NA non-coding downstream 275589 62952124 ~ 62952504 (-)
G69981 NA non-coding upstream 148 63228695 ~ 63228941 (-)
G69982 NA non-coding upstream 1810 63230357 ~ 63230588 (-)
G69983 NA non-coding upstream 2435 63230982 ~ 63231194 (-)
G69984 NA non-coding upstream 2922 63231469 ~ 63231713 (-)
G69985 NA non-coding upstream 3960 63232507 ~ 63232818 (-)
G69210 NA other downstream 809797 62411522 ~ 62418296 (-)
LOC110526417 LOC106576819 other downstream 1245698 61981652 ~ 61983330 (-)
G68736 NA other downstream 1541785 61682278 ~ 61686308 (-)
LOC110526097 LOC106576849 other downstream 2766859 60430184 ~ 60495300 (-)
LOC110525695 LOC106576879 other downstream 4072948 59144373 ~ 59199471 (-)
G70013 NA other upstream 48661 63277208 ~ 63277752 (-)
LOC110526867 LOC100136521 other upstream 1141355 64369803 ~ 64384521 (-)
tjap1 tjap1 other upstream 3590297 66806836 ~ 66883731 (-)
LOC110527436 ppp2r5d other upstream 3766135 66965664 ~ 67010646 (-)
LOC110527584 LOC106576720 other upstream 4157962 67386509 ~ 67389299 (-)

Expression


G69980 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 0.8.
End of interactive chart.

G69980 Expression in each Bioproject

Bar chart with 5 bars.
G69980 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 5.
End of interactive chart.

Co-expression Network