G70011



Basic Information


Item Value
gene id G70011
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048565.1
NCBI id CM023219.2
chromosome length 95772356
location 63274963 ~ 63275296 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU77508
catggaagaccgggtggacgcgacgaaggtatcgcggaagaagaagtcgaactgcgacaggattaatgacctgagaaatacggaatggaccaatgaaccgcggggtcaacttgcgagaagtggtcttaaggggaaggttctgagtggagagccaaactctctgaccgcgacaatatctaggactcttagttctacgcttattagcagccctcacagtctgcgccctataacggcaaagtgcagacctgaccctcttccaggtgcgctcgcaacgttggacaaaagcctgagcggaggggacgctggactcggcgaactgagatgagaacagcgg

Function


NR:

description
PREDICTED: uncharacterized protein LOC106524420

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU77508 True 334 TUCP 0.39 1 63274963 63275296

Neighbor


gene id symbol gene type direction distance location
LOC118965245 LOC106576791 coding upstream 29518 63239050 ~ 63245445 (+)
LOC110526701 LOC106576791 coding upstream 35726 63225088 ~ 63239237 (+)
LOC110526678 LOC106576796 coding upstream 129419 63075377 ~ 63145544 (+)
ide LOC106576795 coding upstream 244342 62983943 ~ 63030621 (+)
LOC110526643 LOC106576799 coding upstream 326891 62923989 ~ 62948072 (+)
LOC110526727 LOC106576790 coding downstream 8031 63283327 ~ 63292127 (+)
LOC110526770 LOC106576788 coding downstream 48606 63323902 ~ 63499450 (+)
LOC110526778 LOC106576786 coding downstream 290207 63565503 ~ 63598806 (+)
LOC110526795 NA coding downstream 344941 63620237 ~ 63621429 (+)
LOC118965254 NA coding downstream 705837 63980371 ~ 63998531 (+)
G70008 NA non-coding upstream 2800 63271844 ~ 63272163 (+)
G70006 NA non-coding upstream 3754 63270908 ~ 63271209 (+)
G70003 NA non-coding upstream 6614 63268145 ~ 63268349 (+)
G69835 NA non-coding upstream 25657 63248967 ~ 63249306 (+)
G69829 LOC106576794 non-coding upstream 53991 63220026 ~ 63220972 (+)
G70012 NA non-coding downstream 2073 63277369 ~ 63277799 (+)
G70021 LOC106576789 non-coding downstream 24646 63299942 ~ 63313337 (+)
G70028 NA non-coding downstream 47213 63322509 ~ 63322810 (+)
G70034 NA non-coding downstream 52557 63327853 ~ 63328057 (+)
G67930 mcmbp other upstream 1541575 61729765 ~ 61733388 (+)
G67806 LOC106581772 other upstream 1959711 61314874 ~ 61315252 (+)
G66188 NA other upstream 3332899 59941486 ~ 59942064 (+)
G65442 NA other upstream 3949834 59324636 ~ 59325129 (+)
G64338 NA other upstream 4574584 58699296 ~ 58700379 (+)
LOC110526969 stk32c other downstream 1534293 64809255 ~ 64946164 (+)
LOC110527164 LOC106576754 other downstream 2640439 65915581 ~ 65922285 (+)
G73515 NA other downstream 3012383 66287679 ~ 66288469 (+)
LOC118965274 LOC106576739 other downstream 3145199 66417495 ~ 66424081 (+)
G74067 LOC106576735 other downstream 3480911 66756207 ~ 66758984 (+)

Expression


G70011 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G70011 Expression in each Bioproject

Bar chart with 17 bars.
G70011 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.

Co-expression Network