G70012



Basic Information


Item Value
gene id G70012
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048565.1
NCBI id CM023219.2
chromosome length 95772356
location 63277369 ~ 63277799 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU77509
cgacagagagtatagtctaccccgggggggagtggttcccggaaggagatcaatactacaatcatacgaccggtgtggaggaagagaggtggccctggaccgactgaacaccgtgcgcagatcgtgatattcctccggcacccctgtcaaatcaccaggctcctcctgtgaagaagagacagaggaaacaggagggatagcagacattaaacatttcacatgacaagcgacgttccaggagaggatagaattactagaccaattaatggaaggattatgacaaactagccagggatggcccaaaacaacaggtgtaaaaggtgaacgaaaaattaaaaaataaatggtttcgctatgattaccagaaacagtgagggttaaaggtagcgtctcacgctgaatcctggggagaggactaccatccagggcga

Function


NR:

description
Retrotransposable element Tf2 protein type 1

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU77509 True 431 lncRNA 0.39 1 63277369 63277799
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118965245 LOC106576791 coding upstream 31924 63239050 ~ 63245445 (+)
LOC110526701 LOC106576791 coding upstream 38132 63225088 ~ 63239237 (+)
LOC110526678 LOC106576796 coding upstream 131825 63075377 ~ 63145544 (+)
ide LOC106576795 coding upstream 246748 62983943 ~ 63030621 (+)
LOC110526643 LOC106576799 coding upstream 329297 62923989 ~ 62948072 (+)
LOC110526727 LOC106576790 coding downstream 5528 63283327 ~ 63292127 (+)
LOC110526770 LOC106576788 coding downstream 46103 63323902 ~ 63499450 (+)
LOC110526778 LOC106576786 coding downstream 287704 63565503 ~ 63598806 (+)
LOC110526795 NA coding downstream 342438 63620237 ~ 63621429 (+)
LOC118965254 NA coding downstream 703334 63980371 ~ 63998531 (+)
G70008 NA non-coding upstream 5206 63271844 ~ 63272163 (+)
G70006 NA non-coding upstream 6160 63270908 ~ 63271209 (+)
G70003 NA non-coding upstream 9020 63268145 ~ 63268349 (+)
G69835 NA non-coding upstream 28063 63248967 ~ 63249306 (+)
G69829 LOC106576794 non-coding upstream 56397 63220026 ~ 63220972 (+)
G70021 LOC106576789 non-coding downstream 22143 63299942 ~ 63313337 (+)
G70028 NA non-coding downstream 44710 63322509 ~ 63322810 (+)
G70034 NA non-coding downstream 50054 63327853 ~ 63328057 (+)
G70035 NA non-coding downstream 53088 63330887 ~ 63331217 (+)
G70011 NA other upstream 2073 63274963 ~ 63275296 (+)
G67930 mcmbp other upstream 1543981 61729765 ~ 61733388 (+)
G67806 LOC106581772 other upstream 1962117 61314874 ~ 61315252 (+)
G66188 NA other upstream 3335305 59941486 ~ 59942064 (+)
G65442 NA other upstream 3952240 59324636 ~ 59325129 (+)
LOC110526969 stk32c other downstream 1531790 64809255 ~ 64946164 (+)
LOC110527164 LOC106576754 other downstream 2637936 65915581 ~ 65922285 (+)
G73515 NA other downstream 3009880 66287679 ~ 66288469 (+)
LOC118965274 LOC106576739 other downstream 3142696 66417495 ~ 66424081 (+)
G74067 LOC106576735 other downstream 3478408 66756207 ~ 66758984 (+)

Expression


G70012 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G70012 Expression in each Bioproject

Bar chart with 17 bars.
G70012 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network