G72523



Basic Information


Item Value
gene id G72523
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048565.1
NCBI id CM023219.2
chromosome length 95772356
location 65086215 ~ 65094495 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU80161
ggtcaataacaaacaagcaagatttctggctctcacagacctgtaacttcttctttaagagtctcctctgtcctccactcgttacctgtattaatggcacctgtttgaacttgttatcagtataaaagacacctgtccacaacctcaaacagtcacactccaaactccactatggccaagaccaaagagctgtcaaaggacaccagaaacaacattgtagacctgcaccaggctgggaagactgaatctgcaataggtaagcagcttggtttgaagaaatcaactgtgggagcaattattaggaaatggaagacatacaagaccactgataatctcc

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU80161 True 337 lncRNA 0.39 2 65086215 65094495
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118964437 NA coding downstream 21418 65063280 ~ 65064797 (-)
LOC110526980 LOC106576770 coding downstream 128543 64951842 ~ 64957672 (-)
LOC110526944 lrrc27 coding downstream 276586 64802392 ~ 64809629 (-)
LOC110526927 LOC106576773 coding downstream 284555 64792360 ~ 64801660 (-)
LOC110526894 LOC106605012 coding downstream 350634 64472402 ~ 64735581 (-)
mcfd2 mcfd2 coding upstream 74347 65168842 ~ 65171950 (-)
stpg4 cssa18h2orf61 coding upstream 135562 65230057 ~ 65235096 (-)
calm2a LOC107561747 coding upstream 145761 65240256 ~ 65245210 (-)
si:ch73-105b23.6 LOC106576763 coding upstream 168786 65263281 ~ 65287052 (-)
plekhh2 plekhh2 coding upstream 207190 65301685 ~ 65372123 (-)
G72455 NA non-coding downstream 89546 64996203 ~ 64996669 (-)
G72454 NA non-coding downstream 93160 64992572 ~ 64993055 (-)
G72402 NA non-coding downstream 94867 64985226 ~ 64991348 (-)
G72410 NA non-coding downstream 139212 64945857 ~ 64947003 (-)
G72432 NA non-coding downstream 143860 64942134 ~ 64942355 (-)
G72595 NA non-coding upstream 100761 65195256 ~ 65198584 (-)
G72610 NA non-coding upstream 130604 65225099 ~ 65226040 (-)
G72636 NA non-coding upstream 197239 65291734 ~ 65292022 (-)
G72639 NA non-coding upstream 200727 65295222 ~ 65296093 (-)
G72648 NA non-coding upstream 225309 65319804 ~ 65320210 (-)
LOC110526867 LOC100136521 other downstream 704859 64369803 ~ 64384521 (-)
G70013 NA other downstream 1808463 63277208 ~ 63277752 (-)
G69210 NA other downstream 2667919 62411522 ~ 62418296 (-)
LOC110526417 LOC106576819 other downstream 3103820 61981652 ~ 61983330 (-)
G68736 NA other downstream 3399907 61682278 ~ 61686308 (-)
tjap1 tjap1 other upstream 1724349 66806836 ~ 66883731 (-)
LOC110527436 ppp2r5d other upstream 1900187 66965664 ~ 67010646 (-)
LOC110527584 LOC106576720 other upstream 2292014 67386509 ~ 67389299 (-)
LOC110527687 sncg other upstream 2575094 67669589 ~ 67681775 (-)
sdhaf4 LOC106576700 other upstream 3063466 68157900 ~ 68162024 (-)

Expression


G72523 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 30.
End of interactive chart.

G72523 Expression in each Bioproject

Bar chart with 21 bars.
G72523 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 750.
End of interactive chart.

Co-expression Network