G72636



Basic Information


Item Value
gene id G72636
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048565.1
NCBI id CM023219.2
chromosome length 95772356
location 65291734 ~ 65292022 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU80299
ATTGAGCTGATGCACCCACTGCGAAAGTCGCAAGAAGAAGTGCAATCCAAATCTTCATAGTTGAATTTGAGAAAAACCGAGAAAAAAAATGGAGTAAACACCTGAACGACACAAGCGTTTACACACTCCAATGATTCCTAGTTCACCAAACGAGCAACGGTATGTCTGCTACACCTGTTTCAACGCTTTCTGGAACAACGTTGTAACGTCTATTGCTATATGATGCTGTAGTTAAGAATCGCTTGATTTATAA

Function


NR:

description
PREDICTED: epithelial cell adhesion molecule isoform X1

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU80299 True 253 lncRNA 0.32 2 65291734 65292022
Loading

Neighbor


gene id symbol gene type direction distance location
si:ch73-105b23.6 LOC106576763 coding downstream 4682 65263281 ~ 65287052 (-)
calm2a LOC107561747 coding downstream 46524 65240256 ~ 65245210 (-)
stpg4 cssa18h2orf61 coding downstream 56638 65230057 ~ 65235096 (-)
mcfd2 mcfd2 coding downstream 119784 65168842 ~ 65171950 (-)
LOC118964437 NA coding downstream 226937 65063280 ~ 65064797 (-)
plekhh2 plekhh2 coding upstream 9663 65301685 ~ 65372123 (-)
LOC118966709 NA coding upstream 228512 65520534 ~ 65551007 (-)
trnai-uau NA coding upstream 511237 65803259 ~ 65803352 (-)
LOC110527131 LOC106576756 coding upstream 519484 65808644 ~ 65822642 (-)
LOC110527186 LOC106576747 coding upstream 728999 66021021 ~ 66141226 (-)
G72610 NA non-coding downstream 65694 65225099 ~ 65226040 (-)
G72595 NA non-coding downstream 93150 65195256 ~ 65198584 (-)
G72530 NA non-coding downstream 196846 65092897 ~ 65094888 (-)
G72523 NA non-coding downstream 197239 65086215 ~ 65094495 (-)
G72455 NA non-coding downstream 295065 64996203 ~ 64996669 (-)
G72639 NA non-coding upstream 3200 65295222 ~ 65296093 (-)
G72648 NA non-coding upstream 27782 65319804 ~ 65320210 (-)
G72778 NA non-coding upstream 211684 65503706 ~ 65504399 (-)
G72780 NA non-coding upstream 216684 65508706 ~ 65509101 (-)
G72810 NA non-coding upstream 269981 65562003 ~ 65562266 (-)
LOC110526867 LOC100136521 other downstream 910378 64369803 ~ 64384521 (-)
G70013 NA other downstream 2013982 63277208 ~ 63277752 (-)
G69210 NA other downstream 2873438 62411522 ~ 62418296 (-)
LOC110526417 LOC106576819 other downstream 3309339 61981652 ~ 61983330 (-)
G68736 NA other downstream 3605426 61682278 ~ 61686308 (-)
tjap1 tjap1 other upstream 1526822 66806836 ~ 66883731 (-)
LOC110527436 ppp2r5d other upstream 1702660 66965664 ~ 67010646 (-)
LOC110527584 LOC106576720 other upstream 2094487 67386509 ~ 67389299 (-)
LOC110527687 sncg other upstream 2377567 67669589 ~ 67681775 (-)
sdhaf4 LOC106576700 other upstream 2865939 68157900 ~ 68162024 (-)

Expression


G72636 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

G72636 Expression in each Bioproject

Bar chart with 1 bar.
G72636 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 20.
End of interactive chart.

Co-expression Network