G73515



Basic Information


Item Value
gene id G73515
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048565.1
NCBI id CM023219.2
chromosome length 95772356
location 66287679 ~ 66288469 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU81252
gtggaacgacatttattggatatttcaaacttttttaacaaatcaaaaactgaaaaattgggcgtgcaaaattattcagcccctttactttcagtgcagcaaactctctccagaagttcagtgcggatctctgaatgatccaatgttgacctaaatgactaatgatgataaatacaatccacctgtgtgtaatcaagtctccgtataaatgcacctgcactgtgatagtctcagaggtccgttaaaagcgcagagcgcatcatgaagaacaaggaacacaccaggcaggtccgacatactgttgtgaagaagtttaaagccggatttggatacaaaaagatttcccaagctttaaacatcccaaggagcactgtgcaagcgataatattgaaatggaaggagtatcagaccactgcaaatataccaagacctggccgtccctctaaactttcagctcatacaaggaaaagactgatcagagatgcagccaagaggcccatgatcactctggatgaactgcagagatctacagctgaggtgggagactctgtccataggacaacaatcagtcagtcgtatattgcacaaatctggcctttatggaagagtggcaagaagaaagccatttcttaaagatatccataaaaagtgttgtttaaagtttgccacaagccacctgggagacacaccaaacatgtggaagaaggtgctctggtcagatgaaaccaaaatggaactttttggcaacaatgcaagacgttatgtttggcgtaaaagcaacacagcagaac

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU81252 True 791 TUCP 0.39 1 66287679 66288469
Loading

Neighbor


gene id symbol gene type direction distance location
wu:fj16a03 LOC100135970 coding upstream 268641 66014081 ~ 66019044 (+)
LOC110527177 LOC106576750 coding upstream 284339 66000257 ~ 66003340 (+)
LOC110532572 LOC106576752 coding upstream 287831 65993868 ~ 65999848 (+)
LOC110527164 LOC106576754 coding upstream 365394 65915581 ~ 65922285 (+)
LOC110527154 LOC106576753 coding upstream 376144 65898427 ~ 65911535 (+)
prph2b LOC106576743 coding downstream 62942 66351411 ~ 66355894 (+)
LOC118965274 LOC106576739 coding downstream 129026 66417495 ~ 66424081 (+)
LOC110527255 LOC106576738 coding downstream 261794 66550263 ~ 66567928 (+)
LOC110527278 qki coding downstream 350456 66638925 ~ 66734658 (+)
yipf3 yipf3 coding downstream 486399 66774868 ~ 66783655 (+)
G73501 NA non-coding upstream 18695 66268585 ~ 66268984 (+)
G73496 NA non-coding upstream 26086 66261094 ~ 66261593 (+)
G73492 NA non-coding upstream 31363 66256094 ~ 66256316 (+)
G73488 NA non-coding upstream 34337 66253121 ~ 66253342 (+)
G73526 NA non-coding downstream 22997 66311466 ~ 66347388 (+)
G73536 NA non-coding downstream 46826 66335295 ~ 66342335 (+)
G73537 NA non-coding downstream 48154 66336623 ~ 66337288 (+)
G73528 NA non-coding downstream 72740 66361209 ~ 66457570 (+)
G73552 LOC106576742 non-coding downstream 81775 66370244 ~ 66371618 (+)
LOC110526969 stk32c other upstream 1386055 64809255 ~ 64946164 (+)
G70011 NA other upstream 3012383 63274963 ~ 63275296 (+)
G67930 mcmbp other upstream 4554291 61729765 ~ 61733388 (+)
G67806 LOC106581772 other upstream 4972427 61314874 ~ 61315252 (+)
G74067 LOC106576735 other downstream 467738 66756207 ~ 66758984 (+)
G74139 NA other downstream 495866 66784335 ~ 66784969 (+)
G75747 NA other downstream 2086036 68374505 ~ 68374929 (+)
G78121 NA other downstream 4283196 70571665 ~ 70654961 (+)

Expression


G73515 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G73515 Expression in each Bioproject

Bar chart with 21 bars.
G73515 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network