G75319



Basic Information


Item Value
gene id G75319
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048565.1
NCBI id CM023219.2
chromosome length 95772356
location 67524716 ~ 67524946 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU83255
atcaaatttatttatatagcccttcgcacatcagctgatatctcaaagtgctgtacagaaacccagcctaaaaccccaaacagcaagcaatgcaggtgtagaagcacggtggctaggaaaaactccctagaaaggccaaaacctaggaagaaacctagagaggaaccaggctatgtggggtggccagtcctcttctggctgtgccgggtggagattataacagaacatggc

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU83255 True 231 lncRNA 0.48 1 67524716 67524946

Neighbor


gene id symbol gene type direction distance location
LOC118965291 NA coding downstream 7901 67515286 ~ 67516815 (-)
LOC118966711 LOC106606039 coding downstream 9499 67514760 ~ 67515221 (-)
ninl ninl coding downstream 25488 67446441 ~ 67499228 (-)
abhd12 LOC106576716 coding downstream 80946 67415739 ~ 67443770 (-)
LOC110527584 LOC106576720 coding downstream 135417 67386509 ~ 67389299 (-)
LOC110527634 nfkb2 coding upstream 50108 67575052 ~ 67593740 (-)
LOC110527672 NA coding upstream 113785 67638731 ~ 67642121 (-)
LOC110527687 sncg coding upstream 144727 67669589 ~ 67681775 (-)
LOC110527713 bmpr1a coding upstream 201192 67726138 ~ 67793350 (-)
LOC118965293 ldb3 coding upstream 272009 67796955 ~ 67813744 (-)
G75315 NA non-coding downstream 4504 67519913 ~ 67520212 (-)
G75314 NA non-coding downstream 5679 67518814 ~ 67519037 (-)
G75246 pygb non-coding downstream 111460 67402541 ~ 67413256 (-)
G75254 NA non-coding downstream 139341 67385119 ~ 67385375 (-)
G75322 NA non-coding upstream 3593 67528539 ~ 67529102 (-)
G75325 NA non-coding upstream 6648 67531594 ~ 67531823 (-)
G75326 NA non-coding upstream 8435 67533381 ~ 67533584 (-)
G75327 NA non-coding upstream 8796 67533742 ~ 67533961 (-)
G75331 NA non-coding upstream 14651 67539597 ~ 67539832 (-)
LOC110527436 ppp2r5d other downstream 514129 66965664 ~ 67010646 (-)
tjap1 tjap1 other downstream 701900 66806836 ~ 66883731 (-)
LOC110526867 LOC100136521 other downstream 3143360 64369803 ~ 64384521 (-)
G70013 NA other downstream 4246964 63277208 ~ 63277752 (-)
sdhaf4 LOC106576700 other upstream 633015 68157900 ~ 68162024 (-)
G75682 NA other upstream 685234 68210180 ~ 68211706 (-)
LOC110527951 coda1 other upstream 1050647 68575379 ~ 68690343 (-)
LOC118965321 LOC106576963 other upstream 2557894 70082835 ~ 70088715 (-)

Expression


G75319 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 30.
End of interactive chart.

G75319 Expression in each Bioproject

Bar chart with 18 bars.
G75319 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 2000.
End of interactive chart.

Co-expression Network