G74945



Basic Information


Item Value
gene id G74945
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048565.1
NCBI id CM023219.2
chromosome length 95772356
location 67699969 ~ 67702937 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU82842
ttttggggcatttctatgttttcggcctagtatggttctcaatcagaggcaggtgtcaatagttgtctctgattgagaatcatacttaggtagcctgggtttcactgtgtgtttgtgggtgattgttcctgtcactgtgtttgttgtcacaggataggactgttttgcgttgtcacatttcttgtttttgttagtttgttcatgtgtagtgatttattaaaacatgaataaccaccacgctgcgctttggtccgcttctcttcctcctacagacgaacgcccttaca

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU82842 True 287 lncRNA 0.46 2 67699969 67702937
Loading

Neighbor


gene id symbol gene type direction distance location
glud1 gdh01 coding upstream 61549 67596677 ~ 67638420 (+)
psda LOC106576711 coding upstream 124920 67528611 ~ 67575049 (+)
aifm2 amid coding upstream 193288 67499187 ~ 67506681 (+)
gins1 gins1 coding upstream 253476 67443706 ~ 67446493 (+)
pygb pygb coding upstream 286684 67388041 ~ 67413285 (+)
mmrn2a mmrn2 coding downstream 2854 67705791 ~ 67724360 (+)
LOC118965297 NA coding downstream 413191 68116128 ~ 68117384 (+)
LOC110527784 LOC106576702 coding downstream 424928 68127865 ~ 68140839 (+)
slc2a15a LOC106576697 coding downstream 572442 68275379 ~ 68295406 (+)
fgf8a LOC106576696 coding downstream 613395 68316332 ~ 68322937 (+)
G74790 NA non-coding upstream 28415 67669671 ~ 67671554 (+)
G74880 NA non-coding upstream 103377 67596369 ~ 67596592 (+)
G74879 NA non-coding upstream 104082 67595523 ~ 67595887 (+)
G74875 NA non-coding upstream 109409 67590236 ~ 67590560 (+)
G74799 NA non-coding upstream 113371 67586368 ~ 67586598 (+)
G74956 NA non-coding downstream 90844 67793781 ~ 67795363 (+)
G75004 NA non-coding downstream 97238 67800175 ~ 67800581 (+)
G75034 NA non-coding downstream 160634 67863571 ~ 67871124 (+)
G75107 NA non-coding downstream 323699 68026636 ~ 68042452 (+)
G75151 NA non-coding downstream 369734 68072671 ~ 68076067 (+)
G74139 NA other upstream 915000 66784335 ~ 66784969 (+)
G74067 LOC106576735 other upstream 940985 66756207 ~ 66758984 (+)
LOC118965274 LOC106576739 other upstream 1275888 66417495 ~ 66424081 (+)
G73515 NA other upstream 1411500 66287679 ~ 66288469 (+)
LOC110527164 LOC106576754 other upstream 1777684 65915581 ~ 65922285 (+)
G75747 NA other downstream 671568 68374505 ~ 68374929 (+)
G78121 NA other downstream 2868728 70571665 ~ 70654961 (+)
ccdc85a ccdc85a other downstream 3333533 71036440 ~ 71076239 (+)
G82111 LOC106577091 other downstream 5848679 73551616 ~ 73571737 (+)
G83836 NA other downstream 7206288 74909225 ~ 74909806 (+)

Expression


G74945 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 12.
End of interactive chart.

G74945 Expression in each Bioproject

Bar chart with 14 bars.
G74945 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network