G75004



Basic Information


Item Value
gene id G75004
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048565.1
NCBI id CM023219.2
chromosome length 95772356
location 67800175 ~ 67800581 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU82901
GGCACAATGCAGGCTGTGCTGACCACCTTGGGTGGAGGAGGGCCCACAGGGATCTGGATAGAGCTTTGCTGCATGGGAGGAGGCTGCTGCATGGGATGTCGCTGCATAGGCGGGGCCTGGTGCATGGGGGGCCCCTGGTACATGGGTGGTCCCTGGTGCATTGGAGGCCCTTGGTACATGGGAGGTCCCTGCTGCATGGAAGGTCCCTTCTGAATACAAAGCCCCTGGTACATGGATTGCCCCTGGTACATGGGAGGGGCTTTTTGCATGGGGGGAGCCTGGCCATATAGGCTGCAGAAGGATAAAAAAGAAGCTGAGTGACATCATCACCACCTAAATTCAAACATATCTCTACTAGTCTTATTACTTCA

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU82901 True 371 lncRNA 0.56 2 67800175 67800581
Loading

Neighbor


gene id symbol gene type direction distance location
mmrn2a mmrn2 coding upstream 75815 67705791 ~ 67724360 (+)
glud1 gdh01 coding upstream 161755 67596677 ~ 67638420 (+)
psda LOC106576711 coding upstream 225126 67528611 ~ 67575049 (+)
aifm2 amid coding upstream 293494 67499187 ~ 67506681 (+)
gins1 gins1 coding upstream 353682 67443706 ~ 67446493 (+)
LOC118965297 NA coding downstream 315547 68116128 ~ 68117384 (+)
LOC110527784 LOC106576702 coding downstream 327284 68127865 ~ 68140839 (+)
slc2a15a LOC106576697 coding downstream 474798 68275379 ~ 68295406 (+)
fgf8a LOC106576696 coding downstream 515751 68316332 ~ 68322937 (+)
fbxw4 fbxw4 coding downstream 538456 68339037 ~ 68396401 (+)
G74956 NA non-coding upstream 4812 67793781 ~ 67795363 (+)
G74945 NA non-coding upstream 97238 67699969 ~ 67702937 (+)
G74790 NA non-coding upstream 128621 67669671 ~ 67671554 (+)
G74880 NA non-coding upstream 203583 67596369 ~ 67596592 (+)
G74879 NA non-coding upstream 204288 67595523 ~ 67595887 (+)
G75034 NA non-coding downstream 62990 67863571 ~ 67871124 (+)
G75107 NA non-coding downstream 226055 68026636 ~ 68042452 (+)
G75151 NA non-coding downstream 272090 68072671 ~ 68076067 (+)
G75117 NA non-coding downstream 277493 68078074 ~ 68079488 (+)
G75165 NA non-coding downstream 295094 68095675 ~ 68096674 (+)
G74139 NA other upstream 1015206 66784335 ~ 66784969 (+)
G74067 LOC106576735 other upstream 1041191 66756207 ~ 66758984 (+)
LOC118965274 LOC106576739 other upstream 1376094 66417495 ~ 66424081 (+)
G73515 NA other upstream 1511706 66287679 ~ 66288469 (+)
LOC110527164 LOC106576754 other upstream 1877890 65915581 ~ 65922285 (+)
G75747 NA other downstream 573924 68374505 ~ 68374929 (+)
G78121 NA other downstream 2771084 70571665 ~ 70654961 (+)
ccdc85a ccdc85a other downstream 3235889 71036440 ~ 71076239 (+)
G82111 LOC106577091 other downstream 5751035 73551616 ~ 73571737 (+)
G83836 NA other downstream 7108644 74909225 ~ 74909806 (+)

Expression


G75004 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G75004 Expression in each Bioproject

Bar chart with 5 bars.
G75004 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 25.
End of interactive chart.

Co-expression Network