G78120



Basic Information


Item Value
gene id G78120
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048565.1
NCBI id CM023219.2
chromosome length 95772356
location 70571504 ~ 70681365 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU86382
aaagatataaaactgtatttttttgtgaagaatcaacaacaagtgggacacaatcatgaagtggaacgacatttattggatatttcaaacttttttaacaaatcaaaaactgaaaaattgggtgtgcaaaattattcagcccccttaagttaatactttgtagcgccaccttttgctgcaattacagctgtaagtcgcttggggtatgtctctatcagttttgcacatcgagagactgaaatatttcccattcctccttgcaaaacagctcgagctcagtgaggttggatggagagcatttgtgaacagcagttttcagttctttccacagattctcgattggattcaggtctggactttgac

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU86382 True 363 lncRNA 0.47 3 70571504 70681365

Neighbor


gene id symbol gene type direction distance location
LOC110528470 LOC106576965 coding upstream 166881 70229959 ~ 70404623 (+)
zswim8 LOC100194729 coding upstream 343000 70194295 ~ 70228504 (+)
LOC110528418 LOC106576964 coding upstream 382566 70163191 ~ 70188938 (+)
chchd1 chch1 coding upstream 427810 70136830 ~ 70143694 (+)
LOC118966712 LOC105023263 coding upstream 448593 70122012 ~ 70122911 (+)
ccdc85a ccdc85a coding downstream 355075 71036440 ~ 71076239 (+)
vrk2 LOC106576978 coding downstream 566737 71248102 ~ 71266030 (+)
LOC110528637 NA coding downstream 599096 71280461 ~ 71323276 (+)
asrgl1 LOC106576984 coding downstream 1283425 71964790 ~ 71978789 (+)
LOC110528701 LOC106576988 coding downstream 1327142 72008507 ~ 72040224 (+)
G78098 NA non-coding upstream 29888 70541121 ~ 70541616 (+)
G78016 NA non-coding upstream 214300 70356982 ~ 70357204 (+)
G78014 NA non-coding upstream 215846 70355262 ~ 70355658 (+)
G78010 NA non-coding upstream 234570 70336648 ~ 70336934 (+)
G78007 NA non-coding upstream 236902 70334366 ~ 70334602 (+)
G78198 NA non-coding downstream 34161 70715526 ~ 70726790 (+)
G78649 NA non-coding downstream 67807 70749172 ~ 70749562 (+)
G78666 LOC106576973 non-coding downstream 90730 70772095 ~ 70774313 (+)
G78728 NA non-coding downstream 181319 70862684 ~ 70866754 (+)
G78992 NA non-coding downstream 319462 71000827 ~ 71001055 (+)
G75747 NA other upstream 2196575 68374505 ~ 68374929 (+)
G74139 NA other upstream 3786535 66784335 ~ 66784969 (+)
G74067 LOC106576735 other upstream 3812520 66756207 ~ 66758984 (+)
LOC118965274 LOC106576739 other upstream 4147423 66417495 ~ 66424081 (+)
G73515 NA other upstream 4283035 66287679 ~ 66288469 (+)
G82111 LOC106577091 other downstream 2870251 73551616 ~ 73571737 (+)
G83836 NA other downstream 4227860 74909225 ~ 74909806 (+)
G83829 NA other downstream 4431295 75112660 ~ 75114190 (+)
G83979 NA other downstream 4463499 75144864 ~ 75145512 (+)

Expression


G78120 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G78120 Expression in each Bioproject

Bar chart with 17 bars.
G78120 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network