G78121



Basic Information


Item Value
gene id G78121
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048565.1
NCBI id CM023219.2
chromosome length 95772356
location 70571665 ~ 70654961 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU86384
aactctctccagaagttcagtgaggatctctgaatgatccaatgttgacctaaatgactaatgatgataaatacaatccacctgtgtgtaatcaagtctccgtataaatgcacctgcactgtgatagtctcagaggtccgttaaaagcgcagagagcatcatgaagaacaaggaacacaccaggcaggtccgagatactgttgtgaagaagtttaaagccggatttggatacaaaaaaaattcccaagctttaaacatcccaaggagcactttgcaagcgataatattgaaatggaaggagtatcagaccactgcaaatctaccaagacctggccgtccctctaaactttcagctcatacaaggagaagactgatcagagatgcagccaagaggcccatgatcactctggatgaactgcagagatctacagctgaggtgggagactctgtccataggacaacaatcagtcatatattgcacaaatctggcctttatggaagagtggcaagaaagccataaaaagtgtcgtttaaagtttgccacaagccacctgggagacacatcaaacatgtggaagaaggtgctctggtcagatgaaaccaaaattgaactttttggcaacaatgcaaaacgttatgtttggcgtaaaagcaacacagctcatcaccctgaacacaccatccccactgtcaaacatggtggtggcagcatcatggtttgggcctgcttttcttcagcagagacagggaagatggttaaaattgatgggaagatggatggagccaaatacaggaccattctggaagaaaacctgatggagtctgcaaaagacctgagactgggac

Function


NR:

description
Tc1-like transporase

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU86384 True 846 TUCP 0.45 3 70571665 70654961
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110528470 LOC106576965 coding upstream 167042 70229959 ~ 70404623 (+)
zswim8 LOC100194729 coding upstream 343161 70194295 ~ 70228504 (+)
LOC110528418 LOC106576964 coding upstream 382727 70163191 ~ 70188938 (+)
chchd1 chch1 coding upstream 427971 70136830 ~ 70143694 (+)
LOC118966712 LOC105023263 coding upstream 448754 70122012 ~ 70122911 (+)
ddx43 ddx43 coding downstream 24922 70679883 ~ 70711478 (+)
ccdc85a ccdc85a coding downstream 381479 71036440 ~ 71076239 (+)
vrk2 LOC106576978 coding downstream 593141 71248102 ~ 71266030 (+)
LOC110528637 NA coding downstream 625500 71280461 ~ 71323276 (+)
asrgl1 LOC106576984 coding downstream 1309829 71964790 ~ 71978789 (+)
G78098 NA non-coding upstream 30049 70541121 ~ 70541616 (+)
G78016 NA non-coding upstream 214461 70356982 ~ 70357204 (+)
G78014 NA non-coding upstream 216007 70355262 ~ 70355658 (+)
G78010 NA non-coding upstream 234731 70336648 ~ 70336934 (+)
G78007 NA non-coding upstream 237063 70334366 ~ 70334602 (+)
kcnq5a LOC106576968 non-coding downstream 18069 70555702 ~ 70677281 (+)
G78198 NA non-coding downstream 60565 70715526 ~ 70726790 (+)
G78649 NA non-coding downstream 94211 70749172 ~ 70749562 (+)
G78666 LOC106576973 non-coding downstream 117134 70772095 ~ 70774313 (+)
G78728 NA non-coding downstream 207723 70862684 ~ 70866754 (+)
G75747 NA other upstream 2196736 68374505 ~ 68374929 (+)
G74139 NA other upstream 3786696 66784335 ~ 66784969 (+)
G74067 LOC106576735 other upstream 3812681 66756207 ~ 66758984 (+)
LOC118965274 LOC106576739 other upstream 4147584 66417495 ~ 66424081 (+)
G73515 NA other upstream 4283196 66287679 ~ 66288469 (+)
G82111 LOC106577091 other downstream 2896655 73551616 ~ 73571737 (+)
G83836 NA other downstream 4254264 74909225 ~ 74909806 (+)
G83829 NA other downstream 4457699 75112660 ~ 75114190 (+)
G83979 NA other downstream 4489903 75144864 ~ 75145512 (+)

Expression


G78121 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G78121 Expression in each Bioproject

Bar chart with 21 bars.
G78121 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network