G81734


Basic Information

Item Value
gene id G81734
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048565.1
NCBI id CM023219.2
chromosome length 95772356
location 73399572 ~ 73400344 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU90265
agggtagcaagttttaagttcctcggcatacacatcacagacaaactgaattggttcactcacacagacagcattgtgaagaaggcgcagcagcgacttctacagatgcacaatcgagagcatcctggcgggctgtatcacccgctccgccctcaaccgtaaggctctccagagggtagtgaggtctgcacaacgcatcaccgggggcaaactacctgccctccaggacacctacaccacccgatgtcacaggaaggccataaagatcatcaaggacatcaaccacccgagccactgcctgttcaccccgctatcatccagaaggcgaggtcagtacaggtgcatcaaagctgggaccgagactgaaaaacagcttctatctcaaggccatcagactgttaaacagccaccactaacattgagtggctgctgccaacacactgacactgactcaactccagccactttaataatgggaattgatgggaaatgatgtaaatatatcactagccactttaaacaatgctaccttatataatgttacttaccctacattattcatctcatatgcatacgtatatactgtactctatatcatcgactgtatccttatgtaatacatgtatcactagccactttaactatgccactttgtttacatactcatctcatatgtatatactgtactcgttaccatctactgtatcttgcctatgctgctctgtaccatcactcattcatatatccttatgtacatattctttatcccctca

Function

NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU90265 True 773 lncRNA 0.45 1 73399572 73400344
Loading

Neighbor

gene id symbol gene type direction distance location
LOC110528965 LOC106577007 coding upstream 577 73386028 ~ 73398995 (+)
LOC110528891 LOC106577001 coding upstream 315736 72816192 ~ 73083836 (+)
LOC110528917 NA coding upstream 399341 72999236 ~ 73000231 (+)
prokr1b LOC106577087 coding upstream 838513 72545613 ~ 72561059 (+)
pcsk2 pcsk2 coding upstream 891439 72419949 ~ 72508133 (+)
LOC110528975 LOC106577008 coding downstream 503 73400847 ~ 73418442 (+)
LOC110528986 LOC106577009 coding downstream 32709 73433053 ~ 73450455 (+)
LOC110529004 LOC106577010 coding downstream 77944 73478288 ~ 73485148 (+)
LOC110529026 LOC106577090 coding downstream 151274 73551618 ~ 73553748 (+)
LOC118936305 LOC106577091 coding downstream 170631 73570975 ~ 73573371 (+)
G81779 NA non-coding upstream 14451 73384811 ~ 73385121 (+)
G81777 NA non-coding upstream 17305 73382041 ~ 73382267 (+)
G81775 NA non-coding upstream 18542 73380547 ~ 73381030 (+)
G81773 NA non-coding upstream 22506 73376857 ~ 73377066 (+)
G81601 NA non-coding upstream 258031 73140481 ~ 73141541 (+)
G81802 NA non-coding downstream 54003 73454347 ~ 73454736 (+)
G81804 NA non-coding downstream 55582 73455926 ~ 73456380 (+)
G81805 NA non-coding downstream 56117 73456461 ~ 73456677 (+)
G81807 NA non-coding downstream 57831 73458175 ~ 73458488 (+)
G82064 NA non-coding downstream 99302 73499646 ~ 73499949 (+)
ccdc85a ccdc85a other upstream 2323470 71036440 ~ 71076239 (+)
G78121 NA other upstream 2744611 70571665 ~ 70654961 (+)
G75747 NA other upstream 5024643 68374505 ~ 68374929 (+)
G74139 NA other upstream 6614603 66784335 ~ 66784969 (+)
G74067 LOC106576735 other upstream 6640588 66756207 ~ 66758984 (+)
G82111 LOC106577091 other downstream 151272 73551616 ~ 73571737 (+)
G83836 NA other downstream 1508881 74909225 ~ 74909806 (+)
G83829 NA other downstream 1712316 75112660 ~ 75114190 (+)
G83979 NA other downstream 1744520 75144864 ~ 75145512 (+)
LOC110529610 NA other downstream 3057780 76457821 ~ 76459823 (+)

Expression

G81734 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 50.
End of interactive chart.

G81734 Expression in each Bioproject

Bar chart with 20 bars.
G81734 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1000.
End of interactive chart.

Co-expression Network