G83718 (LOC106581772)



Basic Information


Item Value
gene id G83718
gene name LOC106581772
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048565.1
NCBI id CM023219.2
chromosome length 95772356
location 74764604 ~ 74765058 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU92354
ctccggtagtaattggcaaaccctaaaaaccgctgcacctcctttaccgtggtcggagtcggccaattacgcacggcattaacgcggtcacactccatcatcatccccgagctggaaatgcgataacccaggaaggaaacggctggtttggaaaacacacatttctcagccttgacgtataggtcatgctccagcagtcgcccaagaaccttgcgcaccagggaaacatgcgcggcgcgtgtggcagaataaatcaagatgtcatcaatatagactaccacaccctgcccgtgcaagtccctgagaatctcatctacaaaggattgaaagacggctggagcatttttcaacccatacggcatgacgaggtactcatagtggcctgatgtggtactaaacgctgttttccactcgtctcctccccgaatacgcaccagattatacgcgctcctgag

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU92354 True 455 lncRNA 0.34 1 74764604 74765058
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110529307 LOC106577031 coding downstream 35758 74709330 ~ 74728846 (-)
LOC110529277 ptpre coding downstream 232979 74479938 ~ 74531625 (-)
gnrh3 NA coding downstream 286326 74477119 ~ 74478278 (-)
mgmt mgmt coding downstream 386450 74348790 ~ 74378154 (-)
LOC110529206 ppp2r2d coding downstream 530487 74229248 ~ 74234117 (-)
fank1 fank1 coding upstream 206714 74971772 ~ 74975108 (-)
edrf1 LOC106577037 coding upstream 217198 74982256 ~ 74996768 (-)
LOC110529369 LOC100380861 coding upstream 347583 75112641 ~ 75133272 (-)
LOC110529412 LOC106577039 coding upstream 370021 75135010 ~ 75148790 (-)
LOC110522123 LOC106577094 coding upstream 580055 75345113 ~ 75348344 (-)
G83674 NA non-coding downstream 29690 74734368 ~ 74734914 (-)
G83504 LOC106572245 non-coding downstream 143774 74620603 ~ 74620830 (-)
G83477 NA non-coding downstream 162499 74601883 ~ 74602105 (-)
G83468 NA non-coding downstream 166370 74597976 ~ 74598234 (-)
G83433 NA non-coding downstream 189250 74575152 ~ 74575354 (-)
G83736 NA non-coding upstream 15259 74780317 ~ 74780539 (-)
G84015 cssa18h10orf90 non-coding upstream 33645 74798703 ~ 74799905 (-)
G84020 NA non-coding upstream 46114 74811172 ~ 74812111 (-)
G84023 NA non-coding upstream 51337 74816395 ~ 74816890 (-)
G84085 NA non-coding upstream 144497 74909555 ~ 74909951 (-)
G83429 NA other downstream 191815 74572447 ~ 74572789 (-)
LOC110528794 LOC106576993 other downstream 2512686 72202814 ~ 72251918 (-)
G80957 NA other downstream 2553515 72207929 ~ 72211089 (-)
G79904 NA other downstream 3020795 71743045 ~ 71743809 (-)
G79700 NA other downstream 3294145 71469435 ~ 71470755 (-)
G84713 NA other upstream 763285 75528343 ~ 75528903 (-)
G85866 NA other upstream 1568410 76333468 ~ 76334136 (-)
ccser2a ccser2 other upstream 1602235 76324531 ~ 76399997 (-)
G86063 NA other upstream 1756027 76516251 ~ 76523481 (-)

Expression


G83718(LOC106581772) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G83718(LOC106581772) Expression in each Bioproject

Bar chart with 21 bars.
G83718(LOC106581772) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network